ID: 941366921

View in Genome Browser
Species Human (GRCh38)
Location 2:164621227-164621249
Sequence CCACACACCTGGGCGGCCAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 193}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941366913_941366921 -7 Left 941366913 2:164621211-164621233 CCTCCCCTGGGCAGCGCCACACA 0: 1
1: 0
2: 0
3: 16
4: 252
Right 941366921 2:164621227-164621249 CCACACACCTGGGCGGCCAGCGG 0: 1
1: 0
2: 1
3: 21
4: 193
941366912_941366921 -6 Left 941366912 2:164621210-164621232 CCCTCCCCTGGGCAGCGCCACAC 0: 1
1: 0
2: 2
3: 15
4: 295
Right 941366921 2:164621227-164621249 CCACACACCTGGGCGGCCAGCGG 0: 1
1: 0
2: 1
3: 21
4: 193
941366907_941366921 18 Left 941366907 2:164621186-164621208 CCGGCGCCAGGTCGTGGGCGTCG 0: 1
1: 0
2: 0
3: 2
4: 48
Right 941366921 2:164621227-164621249 CCACACACCTGGGCGGCCAGCGG 0: 1
1: 0
2: 1
3: 21
4: 193
941366908_941366921 12 Left 941366908 2:164621192-164621214 CCAGGTCGTGGGCGTCGCCCCTC 0: 1
1: 0
2: 0
3: 5
4: 40
Right 941366921 2:164621227-164621249 CCACACACCTGGGCGGCCAGCGG 0: 1
1: 0
2: 1
3: 21
4: 193
941366904_941366921 26 Left 941366904 2:164621178-164621200 CCAGGGGGCCGGCGCCAGGTCGT 0: 1
1: 0
2: 0
3: 8
4: 67
Right 941366921 2:164621227-164621249 CCACACACCTGGGCGGCCAGCGG 0: 1
1: 0
2: 1
3: 21
4: 193
941366914_941366921 -10 Left 941366914 2:164621214-164621236 CCCCTGGGCAGCGCCACACACCT 0: 1
1: 0
2: 1
3: 12
4: 158
Right 941366921 2:164621227-164621249 CCACACACCTGGGCGGCCAGCGG 0: 1
1: 0
2: 1
3: 21
4: 193
941366911_941366921 -5 Left 941366911 2:164621209-164621231 CCCCTCCCCTGGGCAGCGCCACA 0: 1
1: 0
2: 0
3: 31
4: 307
Right 941366921 2:164621227-164621249 CCACACACCTGGGCGGCCAGCGG 0: 1
1: 0
2: 1
3: 21
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941366921 Original CRISPR CCACACACCTGGGCGGCCAG CGG Exonic