ID: 941366924

View in Genome Browser
Species Human (GRCh38)
Location 2:164621238-164621260
Sequence GGCGGCCAGCGGCGAATCCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 84}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941366912_941366924 5 Left 941366912 2:164621210-164621232 CCCTCCCCTGGGCAGCGCCACAC 0: 1
1: 0
2: 2
3: 15
4: 295
Right 941366924 2:164621238-164621260 GGCGGCCAGCGGCGAATCCCGGG 0: 1
1: 0
2: 1
3: 9
4: 84
941366916_941366924 -1 Left 941366916 2:164621216-164621238 CCTGGGCAGCGCCACACACCTGG 0: 1
1: 0
2: 1
3: 21
4: 330
Right 941366924 2:164621238-164621260 GGCGGCCAGCGGCGAATCCCGGG 0: 1
1: 0
2: 1
3: 9
4: 84
941366914_941366924 1 Left 941366914 2:164621214-164621236 CCCCTGGGCAGCGCCACACACCT 0: 1
1: 0
2: 1
3: 12
4: 158
Right 941366924 2:164621238-164621260 GGCGGCCAGCGGCGAATCCCGGG 0: 1
1: 0
2: 1
3: 9
4: 84
941366908_941366924 23 Left 941366908 2:164621192-164621214 CCAGGTCGTGGGCGTCGCCCCTC 0: 1
1: 0
2: 0
3: 5
4: 40
Right 941366924 2:164621238-164621260 GGCGGCCAGCGGCGAATCCCGGG 0: 1
1: 0
2: 1
3: 9
4: 84
941366913_941366924 4 Left 941366913 2:164621211-164621233 CCTCCCCTGGGCAGCGCCACACA 0: 1
1: 0
2: 0
3: 16
4: 252
Right 941366924 2:164621238-164621260 GGCGGCCAGCGGCGAATCCCGGG 0: 1
1: 0
2: 1
3: 9
4: 84
941366911_941366924 6 Left 941366911 2:164621209-164621231 CCCCTCCCCTGGGCAGCGCCACA 0: 1
1: 0
2: 0
3: 31
4: 307
Right 941366924 2:164621238-164621260 GGCGGCCAGCGGCGAATCCCGGG 0: 1
1: 0
2: 1
3: 9
4: 84
941366907_941366924 29 Left 941366907 2:164621186-164621208 CCGGCGCCAGGTCGTGGGCGTCG 0: 1
1: 0
2: 0
3: 2
4: 48
Right 941366924 2:164621238-164621260 GGCGGCCAGCGGCGAATCCCGGG 0: 1
1: 0
2: 1
3: 9
4: 84
941366915_941366924 0 Left 941366915 2:164621215-164621237 CCCTGGGCAGCGCCACACACCTG 0: 1
1: 0
2: 1
3: 54
4: 1089
Right 941366924 2:164621238-164621260 GGCGGCCAGCGGCGAATCCCGGG 0: 1
1: 0
2: 1
3: 9
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941366924 Original CRISPR GGCGGCCAGCGGCGAATCCC GGG Exonic