ID: 941367449

View in Genome Browser
Species Human (GRCh38)
Location 2:164624484-164624506
Sequence TGGGATTCCTGAGGAAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941367449_941367452 -4 Left 941367449 2:164624484-164624506 CCTGTCTTTCCTCAGGAATCCCA No data
Right 941367452 2:164624503-164624525 CCCAGTCTTCCTACCCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941367449 Original CRISPR TGGGATTCCTGAGGAAAGAC AGG (reversed) Intergenic
No off target data available for this crispr