ID: 941376029

View in Genome Browser
Species Human (GRCh38)
Location 2:164731926-164731948
Sequence GGTGGGGAAGGATTCACTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941376018_941376029 29 Left 941376018 2:164731874-164731896 CCAGGCCTGCAGCCTCTGATGCA No data
Right 941376029 2:164731926-164731948 GGTGGGGAAGGATTCACTGTCGG No data
941376022_941376029 0 Left 941376022 2:164731903-164731925 CCAGACAAGGAGTCTCCTGCAGA No data
Right 941376029 2:164731926-164731948 GGTGGGGAAGGATTCACTGTCGG No data
941376020_941376029 17 Left 941376020 2:164731886-164731908 CCTCTGATGCAGTTCTTCCAGAC No data
Right 941376029 2:164731926-164731948 GGTGGGGAAGGATTCACTGTCGG No data
941376019_941376029 24 Left 941376019 2:164731879-164731901 CCTGCAGCCTCTGATGCAGTTCT No data
Right 941376029 2:164731926-164731948 GGTGGGGAAGGATTCACTGTCGG No data
941376017_941376029 30 Left 941376017 2:164731873-164731895 CCCAGGCCTGCAGCCTCTGATGC No data
Right 941376029 2:164731926-164731948 GGTGGGGAAGGATTCACTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941376029 Original CRISPR GGTGGGGAAGGATTCACTGT CGG Intronic
No off target data available for this crispr