ID: 941377570

View in Genome Browser
Species Human (GRCh38)
Location 2:164750692-164750714
Sequence ATGCATTGGAAGGCCAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941377570_941377576 11 Left 941377570 2:164750692-164750714 CCTTCACTGGCCTTCCAATGCAT No data
Right 941377576 2:164750726-164750748 AATTCTTTTCCTTGGCTTGCAGG No data
941377570_941377573 3 Left 941377570 2:164750692-164750714 CCTTCACTGGCCTTCCAATGCAT No data
Right 941377573 2:164750718-164750740 TGAACCCAAATTCTTTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941377570 Original CRISPR ATGCATTGGAAGGCCAGTGA AGG (reversed) Intronic
No off target data available for this crispr