ID: 941388048

View in Genome Browser
Species Human (GRCh38)
Location 2:164877505-164877527
Sequence GAGGGTGGCCCAGTGATTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941388046_941388048 -10 Left 941388046 2:164877492-164877514 CCAGAACCATGATGAGGGTGGCC No data
Right 941388048 2:164877505-164877527 GAGGGTGGCCCAGTGATTGCTGG No data
941388042_941388048 14 Left 941388042 2:164877468-164877490 CCACAAACTAGACTGAGGTGAGA No data
Right 941388048 2:164877505-164877527 GAGGGTGGCCCAGTGATTGCTGG No data
941388040_941388048 21 Left 941388040 2:164877461-164877483 CCAGAAACCACAAACTAGACTGA No data
Right 941388048 2:164877505-164877527 GAGGGTGGCCCAGTGATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941388048 Original CRISPR GAGGGTGGCCCAGTGATTGC TGG Intergenic
No off target data available for this crispr