ID: 941388581

View in Genome Browser
Species Human (GRCh38)
Location 2:164883383-164883405
Sequence ACTCCCTTCCCAATAACCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941388578_941388581 10 Left 941388578 2:164883350-164883372 CCTCAAGAGTCCTCTGAGCTTCA No data
Right 941388581 2:164883383-164883405 ACTCCCTTCCCAATAACCCTAGG No data
941388579_941388581 0 Left 941388579 2:164883360-164883382 CCTCTGAGCTTCACCTACTTATC No data
Right 941388581 2:164883383-164883405 ACTCCCTTCCCAATAACCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941388581 Original CRISPR ACTCCCTTCCCAATAACCCT AGG Intergenic
No off target data available for this crispr