ID: 941391616

View in Genome Browser
Species Human (GRCh38)
Location 2:164921943-164921965
Sequence GTGTTTATGGGGGTTGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941391610_941391616 27 Left 941391610 2:164921893-164921915 CCTGGAAAATCTAAACAAATGCT No data
Right 941391616 2:164921943-164921965 GTGTTTATGGGGGTTGTGGTTGG No data
941391609_941391616 28 Left 941391609 2:164921892-164921914 CCCTGGAAAATCTAAACAAATGC No data
Right 941391616 2:164921943-164921965 GTGTTTATGGGGGTTGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941391616 Original CRISPR GTGTTTATGGGGGTTGTGGT TGG Intronic
No off target data available for this crispr