ID: 941394086

View in Genome Browser
Species Human (GRCh38)
Location 2:164952846-164952868
Sequence TATTATATGCAGAAATTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 494
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 461}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941394086_941394089 28 Left 941394086 2:164952846-164952868 CCCTTCAATTTCTGCATATAATA 0: 1
1: 0
2: 3
3: 29
4: 461
Right 941394089 2:164952897-164952919 CGTATTTGTAAGTTGCACATAGG 0: 1
1: 0
2: 0
3: 8
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941394086 Original CRISPR TATTATATGCAGAAATTGAA GGG (reversed) Intronic
904868224 1:33599345-33599367 TATTATATCTAGATATTGACAGG - Intronic
905007322 1:34720369-34720391 GATTTTATGCTGAAAGTGAAAGG + Intronic
906781562 1:48577232-48577254 TATTATATGCATAAGTTGAAGGG + Intronic
907059134 1:51403221-51403243 TTTTATATGTATAAATTCAAGGG + Intronic
907062336 1:51442515-51442537 TATTTTATGTAGCATTTGAAGGG + Intronic
908139211 1:61166211-61166233 CATTATAGGTAGATATTGAATGG - Intronic
908197806 1:61762362-61762384 TATAATATTCAGAAATAAAAAGG - Intronic
908679103 1:66639802-66639824 GATTTTATGCGGAAATTGATTGG + Exonic
909209055 1:72799279-72799301 TATTTTATGCAACAAATGAAGGG + Intergenic
909244167 1:73255934-73255956 TTTTACATGCAGAAGCTGAAAGG + Intergenic
909440712 1:75692504-75692526 GATTCTATGCAGAAGTAGAAGGG + Intergenic
909745404 1:79089994-79090016 TATTATAAGCAGATAGTAAATGG + Intergenic
909791896 1:79690064-79690086 TTTTATATAGAGAAAATGAAGGG + Intergenic
910136959 1:83983731-83983753 TATAATATCCAGAATCTGAAAGG + Intronic
910464059 1:87477812-87477834 TATAATATGGAGGGATTGAAGGG - Intergenic
910545106 1:88407035-88407057 TATTATATCCAGATATTGTCAGG - Intergenic
910709007 1:90159348-90159370 TAATATTTTCAGAACTTGAATGG + Intergenic
911366114 1:96939545-96939567 TTTTATCTGCACAAAATGAATGG + Intergenic
911995354 1:104758694-104758716 AATTATATGCAGATAGTAAAAGG + Intergenic
912160422 1:106976500-106976522 TATCATAAAAAGAAATTGAAAGG - Intergenic
912722767 1:112034036-112034058 TATTTTATGCAGACCTTCAATGG + Intergenic
912907793 1:113724934-113724956 TATTTTTGGCAGAAATAGAAAGG - Intronic
913232922 1:116756613-116756635 TAGTATATGGACAAATTGAATGG - Intronic
913372893 1:118120466-118120488 TATTTTATGCCCAAACTGAAAGG + Intronic
914358831 1:146912593-146912615 TATAATATGGAGCAATTGAAGGG - Intergenic
914742325 1:150475299-150475321 TTTTTTTTGCAGAAATTAAATGG + Intronic
915277428 1:154799258-154799280 TATTATATGATCAAACTGAAAGG + Intronic
916612235 1:166403809-166403831 TATTCTGTGCAGAAAGTCAATGG + Intergenic
917576832 1:176331384-176331406 AATCATATGTAGAATTTGAATGG + Intergenic
918391704 1:184071091-184071113 TATTATATGAATCAATTAAATGG - Intronic
918731066 1:187997294-187997316 TATTTGTAGCAGAAATTGAATGG - Intergenic
918986932 1:191643198-191643220 TTTTATATACAGAAATGGAAGGG - Intergenic
919073871 1:192790588-192790610 TATGATTAACAGAAATTGAAAGG + Intergenic
919454884 1:197809645-197809667 TTTTATATTCACAAATTGACAGG + Intergenic
919463558 1:197906583-197906605 TATTATAAGCAAAAAATAAATGG + Intronic
921394075 1:214650265-214650287 TATTTTTTTTAGAAATTGAAAGG + Intronic
922818080 1:228465222-228465244 TTTTAACTGGAGAAATTGAATGG + Intergenic
924365630 1:243290421-243290443 TTTTCTATGGAGAAATTGGAGGG - Intronic
924919104 1:248607480-248607502 CATAATTTGCATAAATTGAACGG - Intergenic
1063099276 10:2935389-2935411 TATTATTTGCAGCAATACAAGGG + Intergenic
1064363616 10:14687705-14687727 TTTTAGAGGCAGAAATGGAATGG - Intronic
1065072406 10:22039361-22039383 TATTATATTTAGAAACTAAAAGG + Intergenic
1065352504 10:24808047-24808069 AATTATATGGAGAAGTAGAATGG + Intergenic
1065944063 10:30591223-30591245 TATTATATGCAGGAAGTCATTGG + Intergenic
1067130004 10:43555290-43555312 TCTTCTCTGCAGAAGTTGAATGG - Intergenic
1068181912 10:53532174-53532196 TATTAGAAACAGAAGTTGAAAGG + Intergenic
1069087299 10:64156040-64156062 TATTGGATTCATAAATTGAATGG + Intergenic
1069103221 10:64350292-64350314 TATTATAAGTAGAAAATAAATGG + Intergenic
1069876181 10:71564428-71564450 TAAGTTATGCAGAAATTAAATGG + Intronic
1070215478 10:74375126-74375148 ATTTATATGCAGAAAGTGTAAGG - Intronic
1070490649 10:76972907-76972929 TTCTTTATGCAGAAATTGATAGG - Intronic
1072512471 10:96141353-96141375 TATAAGAAGCAGAATTTGAAAGG + Intronic
1072606323 10:96986080-96986102 TATTATTTCCAGTAATAGAAAGG + Exonic
1073061970 10:100738576-100738598 TAATTGATTCAGAAATTGAAAGG + Intronic
1073220749 10:101871332-101871354 AATTTTATACAGAAATGGAAAGG + Intronic
1073581507 10:104670698-104670720 TGTTTTTTGCAGAAATAGAAAGG - Intronic
1074241564 10:111644383-111644405 TATTGTGTGCAGAAATAGAGGGG - Intergenic
1074292708 10:112151952-112151974 TTTTAAATGCAGAACTTGAGAGG + Exonic
1074324101 10:112431035-112431057 TATTATAAGCACAGTTTGAAGGG + Intronic
1074328638 10:112479676-112479698 GATTATTTTCAGAAGTTGAATGG - Intronic
1074663717 10:115693257-115693279 TATTATGGGCAGAAATGAAATGG + Intronic
1075225269 10:120623421-120623443 TATTATTTTAAGAAATTGACAGG + Intergenic
1075412157 10:122236307-122236329 AATTATGAGAAGAAATTGAATGG - Intronic
1077735416 11:4785674-4785696 TTCTATTTGCAGAATTTGAAAGG - Intronic
1078139976 11:8685135-8685157 TATTATCTGGAGAACATGAAGGG - Intronic
1078392461 11:10947790-10947812 AATTCTATGCAGAAAGTCAATGG + Intergenic
1079782681 11:24627887-24627909 AAATATATGCACACATTGAAGGG - Intronic
1080207336 11:29745349-29745371 TATTATATGCATATATTGATAGG + Intergenic
1080594802 11:33762046-33762068 TATTATATGAAAAAGGTGAAGGG - Intronic
1080929186 11:36789730-36789752 TATTTTATGGAGGAATGGAAAGG + Intergenic
1081166489 11:39814541-39814563 AATTCTATGAAGAAAGTGAATGG - Intergenic
1084149522 11:67281656-67281678 TATGACATGCAGACAATGAATGG - Exonic
1086003355 11:82006145-82006167 TATTATTTTCAGCAATAGAATGG + Intergenic
1086046964 11:82544278-82544300 TATTATATTCAAAATCTGAAAGG - Intergenic
1086453745 11:86941878-86941900 TGTTAGATGGAGAAACTGAAGGG - Intronic
1086659788 11:89401194-89401216 TATTATATGCAGAAGAGGCATGG - Intronic
1086859880 11:91913279-91913301 TATCACATATAGAAATTGAATGG + Intergenic
1087489529 11:98806591-98806613 TATTATTTGTATAAATTTAAAGG + Intergenic
1089142619 11:116299167-116299189 AGATAAATGCAGAAATTGAAAGG - Intergenic
1089197871 11:116705554-116705576 CTTAATGTGCAGAAATTGAAAGG + Intergenic
1089234475 11:117011494-117011516 TATTTTCTACAGAAATTAAACGG + Intronic
1089275009 11:117328737-117328759 TATTAGATGAATAAATTAAAGGG - Intronic
1089855207 11:121537505-121537527 TATTAAATGCAGACATGGACAGG + Intronic
1093255657 12:16864168-16864190 AATTATTTGCTGAAATTTAAGGG - Intergenic
1093360191 12:18216445-18216467 TCTTCTTTGGAGAAATTGAATGG - Intronic
1093401286 12:18749873-18749895 TAACAAATGCAAAAATTGAAAGG + Intergenic
1093424436 12:19012070-19012092 TATTATTTGTATAAATTTAAGGG - Intergenic
1094212477 12:27906809-27906831 TATTATATGAATAAATGGAGAGG + Intergenic
1094751175 12:33410230-33410252 TATTATGTGCATTAATAGAATGG + Intronic
1095468716 12:42514286-42514308 TATGAAATGCAGAAAATAAAAGG - Intronic
1095582489 12:43816075-43816097 TATTTTGTGCACAAATTGTAAGG + Intergenic
1097606343 12:61759105-61759127 TATTATATGTTGAAAAAGAAAGG + Intronic
1097622940 12:61963694-61963716 AATTATGTGCAGAAAGTCAATGG - Intronic
1098424173 12:70340779-70340801 TGTTATATGAAGAGATTGTACGG - Intronic
1100038688 12:90283911-90283933 TATTTTCTACAGAAATTGAATGG - Intergenic
1100289979 12:93204508-93204530 TCTTATTTGGAGAAACTGAATGG + Intergenic
1102856812 12:116301303-116301325 TATTATCTGTAAAAATGGAAAGG - Intergenic
1105234792 13:18539563-18539585 GTTTCTATGCAGAAATTGCATGG + Intergenic
1105512678 13:21063444-21063466 TATTTTATGCACAAATTTTAAGG - Intergenic
1105757112 13:23476743-23476765 TTTTTTTTGCAGAAATTGACAGG - Intergenic
1107652951 13:42562968-42562990 TATTAGTTGCAGAAATTGAGGGG + Intronic
1108830251 13:54468853-54468875 TATTATATGATGAAGATGAAGGG + Intergenic
1109129578 13:58565144-58565166 TCTTATAGGAAGAAATTGAGAGG - Intergenic
1109531955 13:63661595-63661617 TATTATAAGTAGAAAATGCATGG - Intergenic
1109689014 13:65861722-65861744 TGTGATATGCAGAAATAGATTGG + Intergenic
1109856835 13:68141333-68141355 CATTATATGCAGAAATGACATGG + Intergenic
1110755553 13:79169728-79169750 TATTATTTGTATAAATTTAAAGG - Intergenic
1110886607 13:80645302-80645324 TATTATTTGTACAAATTGATGGG + Intergenic
1110989129 13:82014669-82014691 TATTTTATGCATAAATAGAGAGG + Intergenic
1111788611 13:92823857-92823879 TGTCATATGCAGAAATATAATGG - Intronic
1112926493 13:104681542-104681564 TATAATATGTAGAAAATAAAGGG - Intergenic
1114142665 14:19933277-19933299 TATTAAATGCAGTTATTTAATGG - Intergenic
1114894747 14:26973556-26973578 TGTTATATGCAGAAAAAGATAGG - Intergenic
1114964887 14:27945088-27945110 TATTATTGGCAGACATTGTAAGG - Intergenic
1115083228 14:29482980-29483002 TAGTATTTGCTTAAATTGAAAGG - Intergenic
1116201301 14:41801211-41801233 TTTTATATGCAGATATGGAGTGG - Intronic
1116286721 14:42983222-42983244 TTTTGTATTTAGAAATTGAAAGG - Intergenic
1116449582 14:45049673-45049695 TATTATATTCACAAATTTTAGGG + Intronic
1116609515 14:47049719-47049741 CATTCTATGCAGAATATGAAAGG - Intronic
1118169200 14:63369449-63369471 AATTTTATGCAGAAATGCAAAGG + Intergenic
1118266195 14:64296815-64296837 AATAATAAGCAGAAAATGAATGG + Intronic
1118303941 14:64638970-64638992 TTTTATTTGCATAAATTTAAGGG - Intergenic
1118540636 14:66820181-66820203 TATAATAAACAGAAATTGGAAGG - Intronic
1119066431 14:71532093-71532115 TATAATATGTATAAATTAAAGGG - Intronic
1120253796 14:82092302-82092324 TAATATATGCAGAAATACGAAGG + Intergenic
1122289183 14:100670616-100670638 TTTTGTTTGCAGAAAGTGAAAGG - Intergenic
1123173505 14:106396754-106396776 TATACTATGCAGACACTGAAGGG - Intergenic
1123671059 15:22657902-22657924 TAGAAAGTGCAGAAATTGAACGG + Intergenic
1124105449 15:26733609-26733631 TGTTTTATGCAGAAAAAGAAAGG + Intronic
1124733386 15:32220052-32220074 TATTATAGGTTGAAAATGAAAGG - Intergenic
1125000157 15:34761229-34761251 TATTTTATGCAGAAGTGGGATGG + Intergenic
1125069864 15:35541173-35541195 TTTTATAGGAAGAAATGGAAAGG - Intronic
1125299442 15:38238884-38238906 TACTATAGGGAGAAATTCAATGG - Intergenic
1126407828 15:48339952-48339974 CATTATATGAGAAAATTGAAAGG + Intronic
1128040765 15:64571367-64571389 TATTATATGAATAGATTAAATGG + Intronic
1130500173 15:84491416-84491438 CATTATATTTAGAAATTAAATGG - Intergenic
1130630686 15:85565818-85565840 AATCATATGCAGAAATAGAGTGG - Intronic
1132010542 15:98272255-98272277 TAATATAACCAGAAATTGAAAGG + Intergenic
1136937401 16:34485097-34485119 AATGAAATGGAGAAATTGAATGG + Intergenic
1136944406 16:34629971-34629993 AATCGAATGCAGAAATTGAATGG - Intergenic
1136944441 16:34630415-34630437 AATCAAACGCAGAAATTGAATGG - Intergenic
1136950487 16:34711820-34711842 AATCAAATGGAGAAATTGAATGG - Intergenic
1136954320 16:34762838-34762860 AATCAAATGAAGAAATTGAATGG - Intergenic
1136962416 16:34863450-34863472 AATGAAATGGAGAAATTGAATGG - Intergenic
1137086855 16:36136110-36136132 AATGAAATGGAGAAATTGAATGG - Intergenic
1137087248 16:36141389-36141411 AATTGAATGGAGAAATTGAATGG - Intergenic
1137091306 16:36194813-36194835 AATCAAATGGAGAAATTGAATGG - Intergenic
1137091413 16:36196059-36196081 AATTGAATGGAGAAATTGAATGG - Intergenic
1137218046 16:46418549-46418571 AATCAAATGGAGAAATTGAATGG + Intergenic
1137349169 16:47695901-47695923 TATTATGTGCAGAACTGGGAAGG - Intronic
1138985952 16:62328707-62328729 TGTTATAGGCAGAACATGAAAGG - Intergenic
1139064536 16:63296294-63296316 TAATAAAAGCAAAAATTGAAGGG + Intergenic
1139127244 16:64093380-64093402 TAGTATATGGAAAAAATGAACGG + Intergenic
1140705877 16:77628725-77628747 TATAATTTGCCAAAATTGAATGG - Intergenic
1143680366 17:8471717-8471739 TCTTATATGAAGCTATTGAAAGG - Intronic
1148187588 17:45655859-45655881 TATTATATGCAAAACTTTATGGG + Intergenic
1148498968 17:48074547-48074569 TAGAATCTGCACAAATTGAAAGG + Intronic
1149543537 17:57486525-57486547 TATTATTTGCATAAAACGAAAGG - Intronic
1151866345 17:76805932-76805954 TATTATGTGCAGATATTGAGAGG + Intergenic
1153149509 18:2074982-2075004 GATACTATGAAGAAATTGAATGG - Intergenic
1153182103 18:2446473-2446495 TTTTATATTCAGAACTTAAAAGG + Intergenic
1153193341 18:2567396-2567418 TAATATATACAGAAATTCTAAGG + Exonic
1153461772 18:5342535-5342557 TGTTATATACAGAATTTGCATGG + Intergenic
1153499604 18:5734788-5734810 TTTTATTTGCATAAATTTAAAGG - Intergenic
1155191162 18:23432116-23432138 TCTTATATGGAGAAAAGGAAAGG + Intronic
1155758788 18:29537566-29537588 TTTTATTCGTAGAAATTGAAGGG + Intergenic
1155865743 18:30962851-30962873 TATTATAAGCAGAAAGTGTATGG - Intergenic
1156182994 18:34627582-34627604 TTTCATTTGCAGATATTGAAAGG - Intronic
1156224175 18:35086623-35086645 AATTATATGTAAAAATTGAAAGG - Intronic
1159620639 18:70634205-70634227 TAATATATCCAGAAAGTGAGGGG - Intronic
1161136917 19:2625386-2625408 TATTTTTTGCAGAAATAGAGGGG + Intronic
1162257138 19:9499620-9499642 TATTCTGTGCAGAAAAAGAAAGG + Intergenic
1166968993 19:46549729-46549751 TATTATTTGTATAAATTTAAGGG + Intronic
1168444778 19:56402672-56402694 AATTAAATGAAGCAATTGAAGGG + Intronic
924975443 2:169976-169998 TATTGTATTCATAAAATGAAGGG + Intergenic
925583913 2:5443590-5443612 TAGTATGTGCAGATATTGATTGG - Intergenic
925600299 2:5602102-5602124 TAATGTATGCAGAAAAAGAAAGG - Intergenic
926993356 2:18704766-18704788 TATTCTATGCAGAATGTAAATGG + Intergenic
927197257 2:20557019-20557041 TATTACATGCAAAATTAGAAAGG - Intergenic
927772584 2:25877291-25877313 TGTTGTATGCAGAAATGAAATGG - Intronic
928280098 2:29938447-29938469 TACTATATTGAAAAATTGAATGG - Intergenic
928564044 2:32524628-32524650 TATTATATACAGTATTTTAATGG - Intronic
928620342 2:33082300-33082322 TATAATGAGCAGAAATTGACTGG - Intronic
928833170 2:35513210-35513232 AATTATATGAAGAAAGTCAATGG + Intergenic
929388884 2:41444639-41444661 TGTTATATGCATAAATAGGATGG + Intergenic
929805005 2:45137179-45137201 AATTCTATGCAGCCATTGAAAGG - Intergenic
930732167 2:54738309-54738331 TATTCTAAGCAGAAATTCTAAGG - Intronic
930829082 2:55724186-55724208 TAGTAGATGCAGAGATAGAAAGG - Intergenic
930890598 2:56381767-56381789 TCTAATGTCCAGAAATTGAAAGG - Intronic
931100847 2:58999149-58999171 TATAATATGCAGAAGCTAAAGGG + Intergenic
931384870 2:61789362-61789384 TATTTTATTCATAAAATGAAGGG + Intergenic
931908799 2:66871583-66871605 TATTATAGACTGCAATTGAAAGG + Intergenic
931968875 2:67564371-67564393 TATTTTCTCCAGAAAATGAAAGG + Intergenic
932898260 2:75666423-75666445 TATTTTATAAAGAAATTGGATGG + Intronic
932967724 2:76497177-76497199 CATTATATGCAGATATTTCAGGG - Intergenic
933316709 2:80724111-80724133 GACAATATGCAGAACTTGAATGG - Intergenic
933593590 2:84260527-84260549 TCTTCTTTGCAGAAATAGAAAGG - Intergenic
935214722 2:100967110-100967132 AATTACATTCAGCAATTGAAAGG + Intronic
935774807 2:106463746-106463768 TGTTTTAAGCTGAAATTGAACGG + Intronic
935905261 2:107832166-107832188 TGTTTTAAGCTGAAATTGAACGG - Intronic
936000702 2:108826760-108826782 GTTTCTTTGCAGAAATTGAAAGG - Intronic
936394721 2:112115934-112115956 TATTACATACAGAAAATAAAAGG - Intronic
936592114 2:113814026-113814048 TATAATAAACAGAAATTGATTGG + Intergenic
936786804 2:116103206-116103228 AATTATATGAAGAAAGTCAATGG + Intergenic
936877314 2:117206434-117206456 AAATATAGGCAGAAATTGAATGG + Intergenic
938514998 2:131995062-131995084 GTTTCTATGCAGAAATTGCATGG - Intergenic
939264616 2:139855187-139855209 AATTGCATGCAGGAATTGAAAGG + Intergenic
940009708 2:149039928-149039950 TATACTATGTAGAAATTGATTGG + Intronic
940477628 2:154184786-154184808 TATTATATGAAAAAATGTAAAGG - Intronic
941394086 2:164952846-164952868 TATTATATGCAGAAATTGAAGGG - Intronic
943966943 2:194348151-194348173 TACTTTTTGCAGAAATTGGAGGG - Intergenic
944565298 2:200984431-200984453 TATTACATGTTGAAATTGAAGGG - Intronic
945012909 2:205483805-205483827 TATTTTATGTAGAATTGGAAGGG + Intronic
945757361 2:213863837-213863859 TATTAATTTCAGTAATTGAATGG - Intronic
945874227 2:215261161-215261183 TATAATTTACAGAAATTCAATGG + Intergenic
946060827 2:216940074-216940096 TTTTTAAGGCAGAAATTGAAAGG + Intergenic
946245667 2:218385935-218385957 TATTGAATGCAGGGATTGAAAGG + Intronic
946684036 2:222249216-222249238 TATTTTTTGTAGAAACTGAAAGG - Intronic
946992525 2:225351367-225351389 AATTATATGCAACAATTTAAAGG + Intergenic
947497217 2:230646630-230646652 TAATATATAAGGAAATTGAAGGG + Intergenic
1169529527 20:6469542-6469564 TATTACATTCTGAAAATGAATGG + Intergenic
1170068016 20:12335581-12335603 TGTCAAATGCAAAAATTGAATGG + Intergenic
1170263924 20:14443607-14443629 TATTATATGCCAAAATGGAAAGG + Intronic
1170692236 20:18626074-18626096 TAGTATATGCGCAAATTGCAGGG - Intronic
1171912050 20:30971977-30971999 TATTCTATGAAGAAAGTGATTGG + Intergenic
1172796500 20:37543010-37543032 TAATATATACAGATGTTGAAGGG + Intergenic
1173414722 20:42845419-42845441 AATTATAATCATAAATTGAAGGG + Intronic
1174043818 20:47718968-47718990 TATAATTTCCTGAAATTGAATGG + Intronic
1174665051 20:52250241-52250263 ATTTATATCCAGACATTGAAAGG - Intergenic
1176778784 21:13167851-13167873 GTTTCTATGCAGAAATTGCATGG + Intergenic
1176894607 21:14361725-14361747 CATTATATGCAGTAATTCCATGG - Intergenic
1177246842 21:18537005-18537027 TATTATATTAAAAAATTCAAAGG + Intergenic
1177311206 21:19395663-19395685 AACTATTTGCAGAAATAGAATGG - Intergenic
1177482921 21:21715462-21715484 GAATATATGGAGAAAGTGAATGG - Intergenic
1177554339 21:22670565-22670587 GATTCTCTTCAGAAATTGAATGG + Intergenic
1177591016 21:23167901-23167923 AATTATATGAAGAAAGTCAATGG + Intergenic
1177975254 21:27841531-27841553 TATTATGTGTTGAAATTAAAAGG + Intergenic
1177976423 21:27856978-27857000 GTTTCTATGCAGAAATTGCATGG + Intergenic
1178708508 21:34893596-34893618 CATTATATGTAGATATTCAAAGG - Intronic
1180533403 22:16370907-16370929 AATTAAATGGAGAAATCGAATGG + Intergenic
1181960961 22:26621613-26621635 TTTTATAGGCAGAAATTGAGGGG + Intergenic
1182761683 22:32727323-32727345 AATAATATGCAGCAATTAAAAGG - Intronic
1182991039 22:34768031-34768053 TATTATTTTCAGAAAATGGAAGG + Intergenic
1183122848 22:35743996-35744018 AATTAAAGGCAGAAATTTAAAGG + Intronic
1203316240 22_KI270737v1_random:14889-14911 AATTAAATGGAGAAATCGAATGG - Intergenic
949441663 3:4087690-4087712 TATTATATAATCAAATTGAAAGG + Intronic
949665704 3:6337098-6337120 TATTATAAGCAGAAAATAACAGG - Intergenic
949705568 3:6812993-6813015 TATTATATGCATATATTAAGAGG + Intronic
950182888 3:10927469-10927491 TATAAAATGCAGACAATGAAAGG - Intronic
950199309 3:11031809-11031831 TTTTATATGTATAAATTTAAGGG + Intronic
951361227 3:21726787-21726809 TATTCTATGAAGAAAGTCAATGG - Intronic
952618548 3:35306052-35306074 TTTTATTTGCAGAAATGCAAAGG + Intergenic
953683569 3:45058751-45058773 TATTCTACTCAGAAATTTAATGG + Intergenic
955229976 3:57089998-57090020 TATTTAATGCAGAAATTCTAAGG + Exonic
955619046 3:60841898-60841920 TGTTATTTGCAGAAATTAATAGG + Intronic
955813373 3:62815949-62815971 GATGATATGAAGAACTTGAATGG + Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956444302 3:69310448-69310470 AATTATCTGCAGAAAGTGGAAGG + Intronic
956974064 3:74559780-74559802 TATTATATTAAGCAATTGCATGG - Intergenic
956975328 3:74572448-74572470 AATACTATGCAGAAATTAAAAGG + Intergenic
957027306 3:75196800-75196822 TGGTATATCCAGAAATTTAAAGG + Intergenic
957119716 3:76074161-76074183 TATTATCTGATGAAACTGAAGGG - Intronic
959102071 3:102022122-102022144 TATTATAAGCAGAAATGCAAAGG - Intergenic
959642930 3:108661715-108661737 TATTAAATGCTGTAATTGAGGGG + Intronic
959822154 3:110748867-110748889 TAATATAAACAGTAATTGAAAGG + Intergenic
960046819 3:113206582-113206604 TATTATATACAGGAAGAGAATGG - Intergenic
960170841 3:114459121-114459143 TATTATGTGCAGAATATGCATGG - Intronic
960233181 3:115253039-115253061 TATTATAAGTAGAATTAGAAAGG + Intergenic
960345009 3:116520232-116520254 TCTAATATGCAGAAATTACAAGG - Intronic
960922712 3:122763958-122763980 TTTAACAGGCAGAAATTGAAGGG - Intronic
961589773 3:127969440-127969462 TATTACATACAAAAATTGATAGG + Intronic
963986006 3:151595563-151595585 TATTATATACATAAATATAATGG + Intergenic
964523207 3:157589064-157589086 TATTATTTGTATAAATTTAAGGG - Intronic
965212623 3:165813675-165813697 TATTTTCTGCAGAAATTTCAAGG + Intronic
965812714 3:172608250-172608272 TTTTGAATCCAGAAATTGAAAGG - Intergenic
966264940 3:178028568-178028590 TATTATATGGAGAGGGTGAAGGG + Intergenic
966313483 3:178620307-178620329 TTTTATATGCAGATTTTAAATGG + Intronic
966375816 3:179294292-179294314 GATTATAATCAGAAATTGATAGG + Intergenic
966730617 3:183148025-183148047 TTTAAAATGCAGAAATTCAAAGG + Intronic
966745564 3:183272929-183272951 TATTCTAAGCAAAAATTAAAAGG - Exonic
966960240 3:184928708-184928730 TAAAATTTGCAGAAATTGATAGG + Intronic
967343754 3:188429812-188429834 TATTGAATGCAGAAAGGGAATGG + Intronic
967565520 3:190966729-190966751 TATGATTTTCAGACATTGAAAGG + Intergenic
967868692 3:194211781-194211803 TATTATGACCAGAAATTAAAGGG + Intergenic
969215789 4:5721292-5721314 TGATATATGCAGACATTGGAAGG + Intronic
970125486 4:12805190-12805212 TATCTTATGGAGAAATTGAAAGG - Intergenic
970558838 4:17262497-17262519 TATTATTTGTATAAATTTAAGGG + Intergenic
971661257 4:29419225-29419247 TATTATTTGGAGCAAATGAAAGG - Intergenic
973696367 4:53494701-53494723 GGTTAGATGCAGAAATTGGAGGG - Intronic
975302300 4:72804553-72804575 AATAATATTCATAAATTGAAAGG + Intergenic
975429161 4:74267841-74267863 TCTTATATTCAGAAATTCATAGG - Intronic
975652286 4:76605828-76605850 TGTTATAGAAAGAAATTGAATGG - Intronic
975909949 4:79255882-79255904 TATTTTATGCAGAAATTTCCAGG + Intronic
976783918 4:88795064-88795086 TATCATATGCAGAACTTTAGTGG + Intronic
976957774 4:90923827-90923849 TTTTATATGCAGACACTTAAAGG + Intronic
977827434 4:101550402-101550424 TATAATGAACAGAAATTGAATGG - Intronic
978013458 4:103715786-103715808 TACTATATGCCGTAAATGAATGG + Intronic
978273973 4:106926445-106926467 TTTTATAGGCAGGAACTGAAAGG - Intronic
978282230 4:107032924-107032946 TATTATTTTCAGAAATGAAATGG - Intronic
978749091 4:112227333-112227355 TATTTTATTCTGAAGTTGAAGGG - Intergenic
980029779 4:127813976-127813998 TATTATATAAAGAAAATTAAAGG - Intronic
980656966 4:135801277-135801299 TTTTATATGTAAAAATTAAATGG + Intergenic
980853015 4:138406171-138406193 TGTTATAAACAGAAATTAAATGG - Intergenic
980945662 4:139318020-139318042 TATAATATTCAGAAAGTGGATGG + Intronic
980979815 4:139644753-139644775 TATCATATGTAAAGATTGAATGG - Intergenic
980986368 4:139698927-139698949 TATTACAAGAAAAAATTGAATGG - Intronic
982005628 4:151060332-151060354 GATTATTTGTAGAAATAGAAAGG - Intergenic
982224768 4:153155402-153155424 AAGAATATGCAGAAATTGGAGGG + Intronic
982963658 4:161874501-161874523 TATAATATTCAGAAATAAAATGG - Intronic
982986147 4:162209428-162209450 TATTATTTATAGTAATTGAAAGG + Intergenic
984374045 4:178904174-178904196 TATCACATGCTGAAATTAAAAGG + Intergenic
984408985 4:179371085-179371107 TATTATATGGAAAAGGTGAAGGG - Intergenic
985469587 5:31127-31149 TATTATATCTAGAATTTCAATGG + Intergenic
986362595 5:6994889-6994911 TATAATATGAAGAAATAAAATGG - Intergenic
986881640 5:12179791-12179813 TATTATATAGAGAAATTGCTAGG + Intergenic
987483282 5:18488018-18488040 TATTCAAAGCAGAAATTAAAGGG + Intergenic
987631993 5:20485595-20485617 CATTATATGAAAAAATTAAAAGG - Intronic
988343202 5:30001761-30001783 TATTATATGCATAATGAGAAGGG + Intergenic
988368518 5:30335090-30335112 TGTCATATGCGGAATTTGAATGG - Intergenic
988635404 5:32978199-32978221 CGTTATATGAACAAATTGAAGGG - Intergenic
989279869 5:39628315-39628337 TTTTATATGGAAAAATTGATGGG + Intergenic
989749856 5:44880249-44880271 TATTAAATGAAGTAATAGAATGG - Intergenic
990017858 5:51087969-51087991 TATGAACTGCAGAAATTGCATGG - Intergenic
991071765 5:62490976-62490998 TATTGAATGCATAAAATGAAAGG + Intronic
991534581 5:67653509-67653531 TATGATATTCTGAAATTGAAAGG + Intergenic
992011335 5:72530779-72530801 TATAATAAACAGAAATTGATTGG + Intergenic
992499635 5:77329307-77329329 CATTATATGCCAAAAATGAATGG + Intronic
992712591 5:79474760-79474782 AATTCTCTGCAGAAACTGAAAGG + Intronic
992879507 5:81092457-81092479 TATTAAATACATAAATTGATTGG + Intronic
993125627 5:83832371-83832393 TACTATATAGAGGAATTGAAAGG + Intergenic
993795039 5:92256520-92256542 GAAAATAGGCAGAAATTGAATGG + Intergenic
994010227 5:94893708-94893730 TATTAAATTCAGTTATTGAAAGG + Intronic
994785209 5:104151048-104151070 TATAATATGCACAGATTGCATGG - Intergenic
995112917 5:108447129-108447151 TATTTTGTGAAGAAATTGACTGG + Intergenic
995474714 5:112536117-112536139 TTATATTTGCAGAAATAGAATGG + Intergenic
995479351 5:112579608-112579630 TATTATTAGCAGGGATTGAAAGG + Intergenic
995631452 5:114137586-114137608 TTTTATATGCAGAAATGGCATGG + Intergenic
995684878 5:114761501-114761523 TCTAATATCCAGAAATTGCAAGG - Intergenic
996793725 5:127321213-127321235 TATTTTATCCATAAAATGAAAGG + Intronic
996833357 5:127764372-127764394 AATTAAATGTAGAAGTTGAAGGG + Intergenic
997090284 5:130848732-130848754 TATTATGCTCAGAAATTCAATGG + Intergenic
997103028 5:130989443-130989465 TATTTTATGGAGATATTAAAAGG + Intergenic
997800914 5:136860982-136861004 TATAAAATGCAGAAATTCAATGG - Intergenic
998318536 5:141207034-141207056 TATTCTCTGGAGAAATTTAATGG - Intergenic
998420556 5:141981218-141981240 TATAATATATAGAAATTGAGAGG + Intronic
998685581 5:144520618-144520640 AATTATATGCAGAAATTCCTAGG - Intergenic
998729625 5:145060054-145060076 AATAATATGCAGACATTAAAAGG - Intergenic
999019506 5:148148049-148148071 TCTTATATGAAGATGTTGAAGGG - Intergenic
999453390 5:151695151-151695173 TATAATAAACAGAAATTTAATGG + Intergenic
1000789544 5:165588647-165588669 TATTAGAGACAGAAATAGAAAGG + Intergenic
1000926556 5:167201384-167201406 TTTTACATGCTGAAAATGAATGG + Intergenic
1003816114 6:9842292-9842314 AATTCTATGCTGAAATAGAATGG - Intronic
1004551276 6:16650229-16650251 TATTATATGGAGAGATGGAAGGG + Intronic
1004647646 6:17578107-17578129 TGTTATATGGAAAAGTTGAAGGG - Intergenic
1004760579 6:18661637-18661659 TCTTATATCCAGAATTTGCAAGG + Intergenic
1005573602 6:27171331-27171353 TTTTTTTTGCAGAAATGGAAAGG - Intergenic
1006490296 6:34381542-34381564 TATTATATACAGAAATTCTCTGG + Intronic
1006999217 6:38293284-38293306 AATTCTATGAAGAAATTCAATGG - Intronic
1008006167 6:46411813-46411835 AATTATGTGCAGAAATGTAATGG + Intronic
1008358203 6:50581179-50581201 TCTTCTATGCAGAAAGTGAATGG - Intergenic
1009376034 6:62970569-62970591 TAGTAAATGGAGAATTTGAATGG + Intergenic
1009467584 6:63991085-63991107 TATCATATACAGAAAGTAAAGGG + Intronic
1009485921 6:64221497-64221519 TATAATAAACAGAAATTTAATGG - Intronic
1009532497 6:64837951-64837973 TGTTATATGCATATATTGCAAGG - Intronic
1009617507 6:66029432-66029454 TATTATACTCAGAAACTGGAAGG - Intergenic
1010465126 6:76158626-76158648 AATTATATGAAGAAAGTCAATGG + Intergenic
1011062382 6:83285547-83285569 TAAGATATGCAAATATTGAAGGG + Intronic
1011187238 6:84691169-84691191 GATAATTTACAGAAATTGAAGGG - Intronic
1011231069 6:85162824-85162846 TATTATATGAAGAAAGATAATGG + Intergenic
1011839629 6:91480358-91480380 TATTATAGGCTAAAATTTAATGG + Intergenic
1012067045 6:94560796-94560818 TATTATATGCTTCAATTCAATGG - Intergenic
1012138847 6:95595161-95595183 TATTTTATGCAGAAAATGAAAGG - Intronic
1012330829 6:97984288-97984310 TATTTTTTGCATAAATTGAGAGG - Intergenic
1012671559 6:102054884-102054906 GATTAAATGCAGTAATTTAAGGG - Intronic
1013721339 6:113032312-113032334 TATTAGATGCAAAAAATGAGAGG + Intergenic
1013856070 6:114573808-114573830 TATTATTTGCATAAATTTAAGGG - Intergenic
1014560224 6:122880828-122880850 AATTCTATGCAGAAAGTCAATGG + Intergenic
1014621390 6:123671461-123671483 TAGCAGATGGAGAAATTGAAGGG - Intergenic
1015760965 6:136660032-136660054 CAGTATATGCATAAATTAAAAGG + Intronic
1015764791 6:136704880-136704902 AATTATATGCAGAAAAAGACAGG + Intronic
1016089365 6:139957071-139957093 TTCTATATTCAGAAATTGGATGG + Intergenic
1016661822 6:146590005-146590027 TATAATATGCATTAATTTAAAGG - Intergenic
1016678593 6:146801512-146801534 TATTAGCTGCATAAATTCAAAGG + Intronic
1016799828 6:148157244-148157266 TACTATGTGCAGGATTTGAATGG + Intergenic
1021919589 7:25471182-25471204 TATTATATGGAGCCATTGATGGG - Intergenic
1026767671 7:73170845-73170867 TATTATTCACAGAAATTCAATGG + Intergenic
1027044139 7:74980553-74980575 TATTATTCACAGAAATTCAATGG + Intronic
1027079506 7:75221805-75221827 TATTATTCACAGAAATTCAATGG - Intergenic
1027828199 7:83143421-83143443 TAATACATCCAGAAATTGAATGG + Intronic
1028163919 7:87516357-87516379 TATTATTAGCAGTAATTGAAAGG + Intronic
1028552328 7:92083098-92083120 TATTAAATGTAGAATTTAAAGGG - Intronic
1028802891 7:94987622-94987644 TATTTTATGCAACCATTGAAAGG + Intronic
1029042194 7:97588148-97588170 TATTATAATAAGAAATTAAATGG + Intergenic
1029098103 7:98105381-98105403 GATTATATGCAGAATTGGTAAGG - Intergenic
1029388726 7:100260389-100260411 TATTATTCACAGAAATTCAATGG - Intronic
1029879782 7:103795983-103796005 TATTATTTACACAAATTGACTGG - Intronic
1030229941 7:107197181-107197203 TAATATATGGAGAACTTGACTGG - Intronic
1030395329 7:108979274-108979296 AATTATGTGAAGAAATTCAATGG + Intergenic
1030410019 7:109164912-109164934 TATTATATGCTGAGACTCAAAGG - Intergenic
1030442824 7:109609920-109609942 CAATATATGCAGAAACTCAAAGG + Intergenic
1030919429 7:115362640-115362662 TATTATGTGAAGAAAGTCAATGG + Intergenic
1031304637 7:120110898-120110920 TTTTATTTGCATAAATTTAAGGG + Intergenic
1031345113 7:120655529-120655551 GTTTATATGCAGTAGTTGAAGGG + Intronic
1031581532 7:123480960-123480982 TAGTATATGTAAAAATTAAATGG - Intronic
1032806407 7:135359247-135359269 TTTTTTCTGCAGAAATTTAAAGG - Intergenic
1034082275 7:148290039-148290061 TGTTATATGCAGAATATAAAGGG + Intronic
1036530892 8:9585772-9585794 TCTTATATGCAGAGACTGAGGGG + Intronic
1036542052 8:9725014-9725036 TATTACCTGTAGATATTGAAAGG + Intronic
1037064085 8:14554325-14554347 TGTTATATGAAGTAATTCAAAGG + Intronic
1037658355 8:20906522-20906544 TATTAGATGCAGGCATTGGAGGG + Intergenic
1038829359 8:31040094-31040116 GATTAGATGCAGAATGTGAAAGG + Intronic
1039214375 8:35252903-35252925 TATTATATCCAGTAAATGACTGG - Intronic
1040454969 8:47587878-47587900 TATTATATGGTGTTATTGAAGGG - Intronic
1041407106 8:57511938-57511960 TATTATTTGGAGAAATATAAAGG - Intergenic
1041526021 8:58806916-58806938 TATTAGATGCAGAAACAGATTGG - Exonic
1042500482 8:69503191-69503213 TATTACGTGAAGAAAGTGAATGG + Intronic
1043414765 8:80035417-80035439 TATCATATCCAGAATATGAAGGG + Intronic
1043576449 8:81664155-81664177 TAATAAATGAAGAAATTAAAAGG - Intronic
1043822672 8:84887881-84887903 TCTTATATGCATATATTTAAGGG + Intronic
1043964253 8:86454143-86454165 TATTATATACTGTAATTGTAAGG - Intronic
1044506137 8:93022189-93022211 TATTAAATGCACAAAAAGAAAGG - Intergenic
1044862555 8:96537008-96537030 TATAATATAGATAAATTGAATGG - Intronic
1045814463 8:106263119-106263141 TATTGTAGGCATAAGTTGAATGG - Intergenic
1045962958 8:107990150-107990172 AATTCTATGGACAAATTGAATGG + Intronic
1046148990 8:110198966-110198988 TTAGATATGGAGAAATTGAAAGG + Intergenic
1046212676 8:111098973-111098995 TATTCTATCAAGAAATTGCATGG - Intergenic
1046662157 8:116959618-116959640 TATGAAAAGCAGAAACTGAAAGG - Intronic
1047135917 8:122078482-122078504 AATTATAAGCAAAATTTGAAAGG + Intergenic
1047800328 8:128302575-128302597 TATACTATGCAGAAACTGTAGGG + Intergenic
1048638624 8:136327630-136327652 GATTTTAAGCAGGAATTGAATGG + Intergenic
1050420711 9:5462475-5462497 TATTTTTTGTAGAAATTTAAGGG + Intronic
1050562528 9:6848984-6849006 TATTACATGCTAAGATTGAATGG + Intronic
1051655293 9:19375313-19375335 AATAATATGCAGAACTTAAAAGG - Intergenic
1051730284 9:20134805-20134827 TCTGCTATGCAGAAATGGAAAGG + Intergenic
1051841682 9:21404961-21404983 TATTAGATACATAATTTGAAAGG - Intergenic
1052527046 9:29631323-29631345 AATTATATGAATGAATTGAAAGG - Intergenic
1052586213 9:30431090-30431112 TATTACAACCAGAAATTCAAAGG + Intergenic
1053492641 9:38521536-38521558 TATTATATGAAGCAATGGAAAGG + Intergenic
1055775363 9:79761992-79762014 TATTAAATGCACAAATGAAAAGG + Intergenic
1056643827 9:88392889-88392911 TGTTACATGCAGAATTTAAAAGG - Intronic
1056728950 9:89147441-89147463 TCGCATATGCAGAAATGGAAGGG - Intronic
1057238288 9:93384192-93384214 TATTATAGGCAGTAATTAGATGG - Intergenic
1057326724 9:94071446-94071468 GATCATATGAAGAAATGGAAAGG - Intronic
1057672875 9:97110471-97110493 TATTATATGAAGCAATGGAAAGG + Intergenic
1058037800 9:100272390-100272412 TCTTTTCTGCAGAAATTTAAAGG + Intronic
1058846622 9:108966804-108966826 TAATATAGGCAGAAAATGGATGG + Intronic
1059118894 9:111623808-111623830 CCTTATATGAAGAAATTCAATGG + Intergenic
1059140649 9:111849780-111849802 TATTAAATGCAAATAATGAAAGG - Intergenic
1059814285 9:117894127-117894149 TATAATATGTAGAATATGAATGG - Intergenic
1060442092 9:123650508-123650530 ACTTATATACAGAAATTGACTGG - Intronic
1060576901 9:124704188-124704210 TATTACCCACAGAAATTGAAAGG - Intronic
1185925944 X:4146565-4146587 TATTATTTGTAGAAATGTAAGGG + Intergenic
1185989964 X:4882714-4882736 TATTATTTGGAGATATTAAAAGG + Intergenic
1186886774 X:13921911-13921933 TATTACATGCAGAAATTTCTAGG + Intronic
1186924033 X:14312440-14312462 TTTTAGATTCAGAAATTGCATGG - Intergenic
1187034128 X:15519768-15519790 TAGTGTGTGCAGAAATTGTATGG + Intronic
1188213189 X:27447196-27447218 TATGATATGCATAAATGGACTGG + Intergenic
1188762023 X:34044190-34044212 TATTATTTGTATAAATTTAAGGG - Intergenic
1188908973 X:35822471-35822493 TATCATATTCAGAAATAAAATGG - Intergenic
1188909492 X:35828715-35828737 AATTTTATGCAGAAATTCAGGGG + Intergenic
1190205417 X:48398935-48398957 TATTATATACAGTAATAGATAGG + Intergenic
1191626262 X:63274543-63274565 CATTTTATGAAGAAATTCAAGGG + Intergenic
1191930789 X:66368955-66368977 TATTATTTAAAGAAATTGAAAGG - Intergenic
1192206879 X:69102188-69102210 TCTTAGAGGCAGAAAGTGAAAGG - Intergenic
1192553552 X:72072172-72072194 AAATATATACAGAACTTGAAAGG - Intergenic
1192591619 X:72364769-72364791 TCTTATATGCATATATTGCATGG - Intronic
1193105112 X:77662375-77662397 GCTTATATGCAGAACTTGACTGG - Intronic
1193383920 X:80848383-80848405 TATTATATACAAAATTTTAAGGG - Intergenic
1194053539 X:89101895-89101917 TTTTAGATTCATAAATTGAAAGG - Intergenic
1194372769 X:93094430-93094452 TATTCTCTGTATAAATTGAATGG - Intergenic
1194555282 X:95350815-95350837 TTTTAAATGGAGAAATTAAAGGG + Intergenic
1195403025 X:104482059-104482081 TATTATAGCCATAAAATGAATGG - Intergenic
1195584117 X:106543949-106543971 TTTTATTTGTAAAAATTGAAGGG + Intergenic
1195698871 X:107686912-107686934 TATTAAATGCCTAAATTGAAGGG + Intergenic
1196560406 X:117140225-117140247 TATTATATACACAAATTGTCAGG - Intergenic
1196562878 X:117172335-117172357 TATTATAAGCAGCAAATGAAAGG + Intergenic
1196810477 X:119625178-119625200 TATAATATGCAGAAATAGTCTGG - Intronic
1197008989 X:121537356-121537378 TAAAAAATGCAGAAATTGAGAGG - Intergenic
1197015763 X:121624561-121624583 TCTTATTTGCATAAATTTAAGGG + Intergenic
1197052761 X:122079664-122079686 TATTATATGCAAAAGTTAGATGG + Intergenic
1197327417 X:125110629-125110651 TTTTTTCTGCAGAAATTGGATGG - Intergenic
1197636389 X:128919499-128919521 CATTATATGGGGAAATGGAAAGG + Intergenic
1197654963 X:129106851-129106873 TATTATGGGCAGCAATAGAAGGG + Intergenic
1197656184 X:129118424-129118446 TTTTATATTCAGAAAATTAATGG - Intergenic
1197984385 X:132252208-132252230 TATAATATCCAGAATCTGAAAGG + Intergenic
1198832662 X:140766810-140766832 TAATATTTGTAGAAATTTAATGG + Intergenic
1199053830 X:143269172-143269194 TATTATATGCTAAAACTAAAAGG - Intergenic
1199337359 X:146634562-146634584 ATTTATTTGCAGAAATTGATAGG + Intergenic
1199363438 X:146949242-146949264 TTTTAAATGCAGAATTTGGAGGG - Intergenic
1199373255 X:147076463-147076485 TATTATATGCAGAGGCTCAAAGG - Intergenic
1199940059 X:152616576-152616598 TACTATATTCATAGATTGAAAGG - Intergenic
1200680810 Y:6208468-6208490 TATTCTCTGTATAAATTGAATGG - Intergenic
1200881839 Y:8222165-8222187 TATGATATACAAAACTTGAAAGG + Intergenic
1200961088 Y:8996815-8996837 TTTTAAATGGAGAAATTGAGAGG - Intergenic