ID: 941394545

View in Genome Browser
Species Human (GRCh38)
Location 2:164957927-164957949
Sequence ATATATATGCAAAAATTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 726
Summary {0: 1, 1: 0, 2: 6, 3: 66, 4: 653}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941394543_941394545 -4 Left 941394543 2:164957908-164957930 CCCTATTTTACTCAAAAATATAT 0: 1
1: 0
2: 9
3: 98
4: 996
Right 941394545 2:164957927-164957949 ATATATATGCAAAAATTCCAAGG 0: 1
1: 0
2: 6
3: 66
4: 653
941394544_941394545 -5 Left 941394544 2:164957909-164957931 CCTATTTTACTCAAAAATATATA 0: 1
1: 0
2: 5
3: 127
4: 1128
Right 941394545 2:164957927-164957949 ATATATATGCAAAAATTCCAAGG 0: 1
1: 0
2: 6
3: 66
4: 653

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941394545 Original CRISPR ATATATATGCAAAAATTCCA AGG Intergenic
900665175 1:3810438-3810460 ATATATATACAAAAATTAGCTGG + Intergenic
900709028 1:4099792-4099814 ATATATATATATAAATTTCAGGG - Intergenic
901675224 1:10879493-10879515 ATATATATACAAAAATTAGCTGG + Intergenic
902248441 1:15137510-15137532 ATACATATGTAAAAATTCATTGG + Intergenic
903613528 1:24634491-24634513 ATATATATGCAAACATGGCCGGG + Intronic
904543186 1:31247889-31247911 ATATATATACAAAAATTAGCTGG - Intergenic
905375294 1:37516042-37516064 TTATCTATGTAAAAATTCCAAGG - Intergenic
905484921 1:38288850-38288872 ATGTAGATGAAAAAATTCCCTGG + Intergenic
906581941 1:46942428-46942450 ATATGCATGTAAAAATGCCAGGG - Intergenic
906601770 1:47136471-47136493 ATATGCATGTAAAAATGCCAGGG + Intergenic
908505676 1:64797133-64797155 CTATATTTGCAAATAGTCCATGG + Intronic
908678182 1:66629620-66629642 ATATAGATGCCAAAAGTCCATGG + Intronic
908781299 1:67692985-67693007 ATTTCTCTGCAAAAATTGCAGGG + Intergenic
908848264 1:68347219-68347241 ATATATATACAAAAATTAGCCGG - Intergenic
908934283 1:69355968-69355990 CAATTTATGCAAAAATTCCTAGG + Intergenic
909176525 1:72368811-72368833 ATATATATGCACTTAATCCAGGG - Intergenic
909195785 1:72621241-72621263 TTATGTAGGCAAAAATTTCATGG - Intergenic
909229287 1:73064625-73064647 TTATTTATCCAAATATTCCATGG + Intergenic
909757228 1:79241632-79241654 ATATAAATGCAAACATGCAAAGG + Intergenic
910286443 1:85560128-85560150 ATATGTAAGCAAAAATACAATGG + Intronic
910745762 1:90572813-90572835 ATATAAATTGAAAAATTCCAAGG - Intergenic
910809553 1:91222131-91222153 ATATATATTCCAAAATTAGATGG + Intergenic
910813585 1:91264321-91264343 AAATAACAGCAAAAATTCCAAGG + Intronic
910907341 1:92194562-92194584 ATATATATATATATATTCCATGG + Intergenic
910919638 1:92329804-92329826 AAATATGTGCAAAAATTCTAAGG - Intronic
910947118 1:92605661-92605683 AAATTTATGAAAAAACTCCAGGG + Intronic
911502253 1:98702546-98702568 ATATAAATATAAAAATACCATGG - Intronic
911722946 1:101211277-101211299 ATATATACACAAAAATTACCTGG - Intergenic
911791519 1:102021539-102021561 ATATAGTGACAAAAATTCCAAGG + Intergenic
911833941 1:102592126-102592148 ATAAATATGCAAAAATTACTAGG + Intergenic
911873688 1:103132074-103132096 ATATATATGCATATATACGATGG - Intergenic
912038034 1:105347174-105347196 ATATATATGCATCCAATCCAGGG - Intergenic
912051386 1:105532862-105532884 ATATATATACACATATACCATGG - Intergenic
912267262 1:108171214-108171236 ATATATGTGGTAAAATTTCAAGG - Intronic
912763711 1:112390340-112390362 TTATATATGCAAAGGTTACAAGG + Intergenic
913998272 1:143669564-143669586 AGATATATGCAAAAACACTATGG + Intergenic
914408297 1:147399908-147399930 ACATATATGCTAAAATTTTATGG - Intergenic
914738138 1:150438126-150438148 ATATATATACAAAAATTAGCCGG + Intronic
914966319 1:152261072-152261094 ATCAATATGCAAAAATCACAAGG - Intergenic
915197852 1:154203419-154203441 ATATATATGCAAAAGTTACCTGG - Intronic
915326679 1:155084490-155084512 ATATACATGCATAAGTTCTATGG - Intronic
915796232 1:158736948-158736970 ATTTGTATTCAAAAATTCAAAGG + Intergenic
915860908 1:159443315-159443337 ATAAATGTTCTAAAATTCCATGG - Intergenic
916028088 1:160852565-160852587 AAATAAATGTGAAAATTCCAAGG + Intronic
916950255 1:169772850-169772872 ACATAAATGGAATAATTCCAGGG - Intronic
917381594 1:174416005-174416027 ATATATATGTAAATTTTCTAGGG - Intronic
917624668 1:176833489-176833511 AGATATTTGCAAACATTCCTAGG + Intronic
917915479 1:179696790-179696812 ATATATATGCACACAATACAGGG + Intergenic
918062026 1:181070226-181070248 CAATATATGAATAAATTCCATGG - Intergenic
918360643 1:183753742-183753764 CTATATATGCCAAAAATTCAAGG - Intronic
918984853 1:191610492-191610514 ACATATATATAAAAATTTCAAGG + Intergenic
920581472 1:207112175-207112197 ATATATATGAAAAATATACATGG - Intronic
921241041 1:213182957-213182979 ATATATATGTAAAAAGTAAAAGG + Intronic
921524291 1:216198172-216198194 ATATATATGAAAATTTTCCTTGG + Intronic
921527098 1:216231179-216231201 ATAAATATGCAATAAATTCAAGG + Intronic
921537467 1:216369759-216369781 ATATATATACAAAAATTAGCTGG + Intronic
921686671 1:218097201-218097223 ATATATTTCCAAAGAGTCCAGGG + Intergenic
921768883 1:219010164-219010186 AAATATATTAAAAGATTCCAGGG - Intergenic
921769129 1:219014040-219014062 ATATATGAGCAAAAATAACATGG + Intergenic
921788280 1:219259423-219259445 ATATATATGTATATATACCATGG + Intergenic
922647177 1:227300456-227300478 ATATATATACACACATACCATGG + Intronic
922908088 1:229191305-229191327 ATATATATGTAAATCTTCCAGGG + Intergenic
924085043 1:240442289-240442311 ATCCATCTGCAAAAATACCAGGG + Intronic
1063419163 10:5897518-5897540 ACATATATCCAATAAGTCCAAGG + Intronic
1064093104 10:12402055-12402077 ATATATATACAAAAATTAGCTGG - Intronic
1064553603 10:16526216-16526238 ATATATATACAAAAATTAGCTGG - Intergenic
1064776008 10:18778040-18778062 ATATATATATAAAATCTCCAGGG - Intergenic
1065040472 10:21689293-21689315 ACATATATGTAATAATTTCAAGG + Intronic
1065182997 10:23145521-23145543 ATATATATGCAAAAATTAGCTGG - Intergenic
1065215221 10:23440924-23440946 TTATATATGCAATTATTCCCAGG - Exonic
1066143242 10:32528784-32528806 ATATATATAAAAGTATTCCATGG - Intronic
1066199087 10:33128337-33128359 ATATATATACAAAAATTAGCTGG - Intergenic
1066635831 10:37498644-37498666 ATATATATACAGAAATTCTCTGG - Intergenic
1068459506 10:57309236-57309258 GTATATATCTAAAATTTCCAAGG - Intergenic
1069153398 10:64994749-64994771 ATATATGTACATAAATACCATGG + Intergenic
1069238169 10:66104359-66104381 ATGTATTTGCAAAAATGACAAGG - Intronic
1069300053 10:66896178-66896200 ATATTTATTCTAAAATTCAAAGG + Intronic
1070022880 10:72604105-72604127 CTATATACATAAAAATTCCATGG + Intronic
1070532963 10:77353478-77353500 ATATATATGCAAAGTCTCTAGGG + Intronic
1071462133 10:85908689-85908711 AAATGTATACAAAAATTTCAAGG + Intronic
1072075992 10:91974446-91974468 ATATATTTTCACAAATGCCATGG - Intronic
1073383406 10:103100072-103100094 ATATATATCAAAAATTTCCCAGG + Intronic
1073864432 10:107785800-107785822 ATATATATGCACAAAACCTAAGG - Intergenic
1074083510 10:110187375-110187397 GTATATATACAGAAATTCTAGGG - Intergenic
1074264032 10:111883262-111883284 TAATATATGGAAAAAATCCAAGG + Intergenic
1074423812 10:113333249-113333271 ATAAATATTCACAATTTCCAGGG - Intergenic
1074874999 10:117606840-117606862 ATATAAATCCATAAATGCCATGG - Intergenic
1075162997 10:120041123-120041145 ATATATATACAAAAATTAGCTGG - Intergenic
1075251406 10:120878545-120878567 AAATATAAAAAAAAATTCCAAGG - Intronic
1076110032 10:127853051-127853073 ATATATATGCAGTCATTCCTTGG + Intergenic
1077547078 11:3177565-3177587 GTATCTTTGTAAAAATTCCACGG - Intergenic
1078028799 11:7726910-7726932 ATATATATGGAATAAATTCATGG + Intergenic
1078780033 11:14429437-14429459 CAAGATATGCAGAAATTCCATGG - Intergenic
1079458854 11:20661924-20661946 ATATATATGGAAATAATACATGG + Intergenic
1079687679 11:23381269-23381291 ATATATATACTATAATTCTATGG + Intergenic
1079695984 11:23483501-23483523 ATAAAAATACAAAAATTCCCTGG + Intergenic
1079812833 11:25016511-25016533 ATATATATGTATATATACCATGG - Intronic
1080700158 11:34637853-34637875 ATATATATGAAAAAAATCTCAGG + Intronic
1081106521 11:39077214-39077236 ATATAGATGCAAAAATTCTCAGG + Intergenic
1081133833 11:39413109-39413131 ATATAAATGTAGAGATTCCAGGG - Intergenic
1081182112 11:39996605-39996627 ATATATGTTCTAAAATTTCAAGG + Intergenic
1081240738 11:40703328-40703350 ATGTAGATGGAAAAATTTCACGG - Intronic
1081360162 11:42167530-42167552 ATGTTTATGCTAAAATTTCAAGG + Intergenic
1081501430 11:43670369-43670391 ATATATATGAAATAATAACATGG - Intronic
1082092664 11:48102562-48102584 ATATATATACAAAAATTAGCTGG - Intronic
1082740654 11:56907359-56907381 AAATGTATGCAAACATTTCATGG - Intergenic
1082758136 11:57098434-57098456 AGATAGATACAAAAATACCAAGG + Intergenic
1083950888 11:65955449-65955471 ATATATATACAAAAATTAGCTGG + Intronic
1084070649 11:66731784-66731806 ATATTTATGCAAAAACTATATGG + Intergenic
1085591290 11:77763797-77763819 CCATATATGCAAAAATTCTGAGG + Intronic
1086267143 11:85014348-85014370 ATATATAAGGAAGAATTACAAGG - Intronic
1087605743 11:100375787-100375809 ATAGATATGCAATGATTGCAGGG + Intergenic
1087978355 11:104578938-104578960 ATATATATACATATATTCCTGGG + Intergenic
1088103485 11:106179966-106179988 ATATATATTCCAAAATTGTATGG + Intergenic
1088148462 11:106714443-106714465 TTATATAGGCAACAATTCCTGGG - Intronic
1089093548 11:115898918-115898940 GTAAATAGGCAAAAATTACAGGG - Intergenic
1089251167 11:117163127-117163149 ATATATCAGGATAAATTCCAAGG - Intronic
1089389895 11:118093708-118093730 TTATATGTGCAAAAATTCACTGG - Intronic
1090169661 11:124589298-124589320 ATAAATAGGCAAGAATACCATGG + Intergenic
1091129310 11:133131708-133131730 AAATATATGCAAACATTCATGGG - Intronic
1091352481 11:134908100-134908122 AAATATGGGAAAAAATTCCAAGG + Intergenic
1092773894 12:11924504-11924526 ATAAATATGCAAGAATTGCCAGG + Intergenic
1093619427 12:21269583-21269605 AGATATATACCAAAAGTCCACGG - Exonic
1093628747 12:21383379-21383401 AAATATAGACCAAAATTCCATGG - Intronic
1093778832 12:23110347-23110369 AAACATATGCAAAAATTAAATGG - Intergenic
1093860436 12:24159319-24159341 ATATTTATGGGAAAAATCCAAGG - Intergenic
1093949107 12:25144077-25144099 ATAAATATACAAAAATTAAATGG + Intronic
1094363956 12:29660606-29660628 GTATATATGAAAGCATTCCAGGG - Intronic
1095289599 12:40462826-40462848 ATATATTTTTAAAAATTCCCTGG - Intronic
1096923005 12:55109908-55109930 ATATATGTTCCAAAATTGCATGG - Intergenic
1097521354 12:60674276-60674298 ATACAGATGCAAAACTTCCCAGG + Intergenic
1097545577 12:60996548-60996570 ATATATATATAAAAGTTCCCAGG - Intergenic
1097926678 12:65135740-65135762 AAATATACTCAAAAATTCAAAGG + Intergenic
1098591371 12:72217442-72217464 CTATATTTGGAAAAATTCAATGG + Intronic
1098662664 12:73116873-73116895 ATATATATTCCAAAATTAAATGG - Intergenic
1098683697 12:73392581-73392603 ATATGTATGAAATAACTCCATGG - Intergenic
1098711815 12:73772297-73772319 ATATATGTTCAAAAATTATATGG + Intergenic
1098783220 12:74715085-74715107 ATATATATACAAAAATTAGCCGG - Intergenic
1098984960 12:77002145-77002167 ATATATATTTAAAATTTCCTGGG + Intergenic
1099009202 12:77271656-77271678 ATATATATGTAAGAATTTCATGG - Intergenic
1099565575 12:84241109-84241131 AAATAAATGCAATAATTGCATGG - Intergenic
1100459070 12:94780613-94780635 ATATATATACGAAAATTCACCGG + Intergenic
1100752773 12:97717562-97717584 ATATAAATACATAAATTCAAAGG - Intergenic
1101031474 12:100664810-100664832 ATATATATACAAAAATTAGCTGG - Intergenic
1101177718 12:102172932-102172954 ATATATGTGAAAGAATTCCTAGG + Intronic
1101200637 12:102432393-102432415 ATTTATAAGAATAAATTCCAAGG + Intronic
1103162576 12:118742227-118742249 ATATATATACAAATATTAGAAGG + Intergenic
1103318101 12:120073334-120073356 TTCTATATGCAAAGTTTCCAAGG - Intronic
1104348933 12:128028000-128028022 AAATGAATGCAAAAAATCCATGG + Intergenic
1104888620 12:132127376-132127398 AAATATATGTAAAAATTACAGGG - Intronic
1105468173 13:20666880-20666902 ATATATTTGTAAAAATGCCTGGG - Intronic
1105613793 13:21993600-21993622 ATTCATAACCAAAAATTCCAGGG - Intergenic
1105742560 13:23343025-23343047 GTATTTCTGCAAAAATCCCAGGG - Intronic
1106125007 13:26894042-26894064 AAATATAAGAAAAAATTACAAGG + Intergenic
1106921354 13:34567424-34567446 ATATATATGTATATATTCCATGG - Intergenic
1107895192 13:44955075-44955097 ATATATATGCAACAAGTTTATGG - Intronic
1108182137 13:47851153-47851175 ATATATATTTAAAAAATACAAGG - Intergenic
1108709289 13:53017103-53017125 TTTTATATGCAAATATTCCCAGG - Intergenic
1108996663 13:56742941-56742963 ATATATATGTATAAATTAAATGG + Intergenic
1109353914 13:61217090-61217112 ATATAAATGCCAACATTGCAGGG + Intergenic
1109389023 13:61669402-61669424 ATATATATTCCAAAATTGTATGG - Intergenic
1109445455 13:62432931-62432953 TTATATATGATAAAATCCCAAGG - Intergenic
1109550389 13:63889985-63890007 AAATATATGTAAAAATACAAAGG + Intergenic
1110035348 13:70675384-70675406 ATATATATAAAAAAATTGCTGGG - Intergenic
1110743528 13:79025916-79025938 ATATATATTCAAAAATTTAATGG + Intergenic
1110851007 13:80245003-80245025 ATAAATAAAAAAAAATTCCAAGG - Intergenic
1111702909 13:91713283-91713305 ATATTTATGAAAAAATTGAAAGG + Intronic
1111852006 13:93587635-93587657 ATTTTTAGGCAAAAATTCCGTGG + Intronic
1112145669 13:96697135-96697157 ATATATATATAAAATCTCCATGG - Intronic
1112177336 13:97039287-97039309 AAATATTTGCTAAAATACCATGG - Intergenic
1112568670 13:100573314-100573336 ACATATATGCACATATTTCATGG - Intronic
1112609166 13:100938991-100939013 ATTTTTATGCAATAATTGCAGGG - Intergenic
1112843382 13:103607395-103607417 CTAAATATGCAGTAATTCCAGGG + Intergenic
1112887394 13:104191494-104191516 ATAGAGATGCATAAATTCCCAGG - Intergenic
1113014245 13:105809364-105809386 ATATAAAAGCAAAAAGTGCAAGG - Intergenic
1113421014 13:110171568-110171590 ATAAAAATGCCAAAATTCTAAGG + Intronic
1113673583 13:112193124-112193146 ATACATATTAAAAAATTCTAGGG + Intergenic
1113831906 13:113302344-113302366 AAATATATACAAAAATTAGACGG - Intronic
1114173986 14:20302604-20302626 ATTTATTTGTAAAAAATCCAAGG - Intronic
1114220823 14:20694689-20694711 AGAGAGATGGAAAAATTCCAGGG + Intronic
1114352898 14:21873715-21873737 ATAAAAATGCATAAATTCAAAGG + Intergenic
1115166449 14:30453342-30453364 ATATATATGTATAAACTCCCAGG + Intergenic
1115517114 14:34196652-34196674 ATATTTATTTAAAAATTCTAAGG - Intronic
1116025974 14:39515378-39515400 TTCTATATGCTAAAATTCCTGGG - Intergenic
1116576687 14:46584153-46584175 ATATATGTTCCAAAATTGCATGG - Intergenic
1116607825 14:47025405-47025427 ATCTATAGGCAGAATTTCCAGGG - Intronic
1117225107 14:53650189-53650211 ATAGATATGCAGAAATGCAAGGG - Intergenic
1117526825 14:56615992-56616014 ATATATTTGCACAAACTGCAAGG - Exonic
1117580535 14:57146950-57146972 AGATATATGCAAAATTGGCAAGG + Intergenic
1117681812 14:58211195-58211217 ATATATTTGAAAAAATTCACAGG - Intronic
1118575478 14:67238153-67238175 GTATATATGCAAAAACTGAAGGG - Intergenic
1120071036 14:80102955-80102977 ATATAGATATAAAAAATCCATGG + Intergenic
1120147716 14:80997592-80997614 TTATATATGCAAGAACTCCAGGG - Intronic
1120559731 14:85975602-85975624 ATATATTTGAAAAACTTGCATGG - Intergenic
1121903298 14:97714820-97714842 AAATATGTGCAAAAAATACAGGG + Intergenic
1202839001 14_GL000009v2_random:102831-102853 ATATATATTTAAAAATTGCCAGG - Intergenic
1202908367 14_GL000194v1_random:92923-92945 ATATATATTTAAAAATTGCCAGG - Intergenic
1202884876 14_KI270722v1_random:96401-96423 ATATATATTTAAAAATTGCCAGG + Intergenic
1123803441 15:23846071-23846093 ATATATATTTTAAAATTCTAAGG + Intergenic
1125351788 15:38775421-38775443 ATCAATATGCAAAAATCACAAGG - Intergenic
1125366662 15:38924454-38924476 ATGTATATGCAAAGAATCTAGGG + Intergenic
1125397378 15:39263888-39263910 ATATATATACTTAAATTCTAGGG - Intergenic
1125631134 15:41148013-41148035 ATATATATCCCAAAATTTTATGG - Intergenic
1126050169 15:44677997-44678019 ATATATATACAAAAATTAGCTGG - Intronic
1126304561 15:47240583-47240605 ATCAAGATGCAAAAATTCCATGG - Intronic
1127357136 15:58210964-58210986 ATATATATATATATATTCCAAGG + Intronic
1127567541 15:60206993-60207015 ATTTGTAAGCAATAATTCCATGG - Intergenic
1127771537 15:62235187-62235209 ATATATATACACACATACCATGG + Intergenic
1127823296 15:62679854-62679876 ATAAATATGATAAAATTGCATGG - Intronic
1131175864 15:90209401-90209423 ATATATATACAAAAATTAGCCGG + Intronic
1131696007 15:94878496-94878518 ATATATGTTCCAAAATTGCATGG - Intergenic
1133183781 16:4080403-4080425 ATATATATACAAAAATTAATCGG - Intronic
1135912114 16:26570914-26570936 ATATATATATAAAAATATCAGGG + Intergenic
1137038442 16:35587710-35587732 ATATATATACAAAAATTAGCTGG - Intergenic
1138608095 16:58101614-58101636 ATATATATACAAAAATTAGCTGG - Intergenic
1138745829 16:59362547-59362569 AGATATATGCAATAATTACCAGG + Intergenic
1139149412 16:64362671-64362693 ATATATCAGCAATAATTTCACGG - Intergenic
1140061252 16:71571470-71571492 ATATATTTGTAAAAAGTGCAGGG + Intronic
1140073799 16:71677486-71677508 ATATATATGGAAGAGTTCAAAGG + Intronic
1140444924 16:75018800-75018822 ACATATGTGCAAAAATCCAAAGG - Intronic
1140464660 16:75171147-75171169 ATTTGTATGCAAATATCCCACGG - Exonic
1140532824 16:75681916-75681938 ATATATATACATACATACCATGG - Intronic
1140687378 16:77446512-77446534 ATGTATATGCTTAAATTCTAGGG + Intergenic
1140741461 16:77945446-77945468 CTATATATATAAAAATTACATGG - Intronic
1140998565 16:80285834-80285856 ATATTTATGGAAACATTCCAAGG + Intergenic
1141325549 16:83055070-83055092 ATATATGTTGAAATATTCCATGG + Intronic
1142294997 16:89215516-89215538 ATATATATGCAAAAGTGGAATGG - Intergenic
1142657095 17:1401294-1401316 ATATATATACAAAAATTAGCTGG + Intergenic
1142855333 17:2726155-2726177 ATATATATACAAAAATTAGCTGG - Intergenic
1144246298 17:13369172-13369194 ATATATATATATATATTCCATGG + Intergenic
1144257435 17:13483159-13483181 ATATATTTGCAAAAAGCCCTAGG + Intergenic
1145003903 17:19325327-19325349 ATATAGATGTAAAAATCCTAAGG + Intronic
1145093701 17:20007186-20007208 ATATTTATGCACAAATAACATGG + Intergenic
1145410211 17:22653763-22653785 TTATATATGTAAAAATTTTAAGG + Intergenic
1146112964 17:30107981-30108003 ATATGTATGCAAAAATGCCAGGG + Exonic
1146377144 17:32302518-32302540 ATATATATACAAAAATTAGCTGG - Intronic
1147565170 17:41531678-41531700 ATAGATATTTAAAGATTCCATGG - Intergenic
1147807819 17:43144631-43144653 ATATTTATGCATAAATAACAAGG - Intergenic
1148196560 17:45717536-45717558 ATATATATACAAAAATTAGCTGG - Intergenic
1148649057 17:49236653-49236675 ATATATATACAAAAATTAGCTGG - Intergenic
1149034486 17:52118662-52118684 ATATATATTCCAAAATTGTATGG + Intronic
1149173407 17:53840933-53840955 ATATATGTTCAAAAATTGCATGG - Intergenic
1149204868 17:54232157-54232179 ATATATATGCACATAATCCAAGG - Intergenic
1149721006 17:58843667-58843689 ATATGTATGCAAAAATTAGCTGG + Intronic
1149746266 17:59101776-59101798 ATATATATACAAAAATAGCCGGG + Intronic
1150516931 17:65822827-65822849 ATATATGTAGAAAAATTCCAAGG + Intronic
1150535647 17:66036796-66036818 ATAAATTTGCAAAAATACCTCGG + Intronic
1150844660 17:68642995-68643017 ATAGATCTGCACAAATTGCATGG - Intergenic
1153066792 18:1054457-1054479 ATATATATGCATAAATACTTAGG + Intergenic
1155018269 18:21868732-21868754 ATATATATGTTAAATTTCCTAGG - Exonic
1155612971 18:27689252-27689274 ACATAGACACAAAAATTCCAAGG - Intergenic
1155745280 18:29348799-29348821 AAATATATTCACAGATTCCAGGG + Intergenic
1156198268 18:34800885-34800907 ATTTATATGGAAAAGTTGCAGGG - Intronic
1156198297 18:34801338-34801360 TTGTATAGGCAAAAGTTCCAGGG + Intronic
1157051435 18:44170595-44170617 AAATATATCCAAACATTGCACGG - Intergenic
1157482410 18:48063860-48063882 ATATAAATGCAAAGATATCATGG - Intronic
1158158993 18:54458381-54458403 ATATATATGTTAAAATTATAGGG + Intergenic
1158183324 18:54742876-54742898 ACATAGATGCAAAATTTGCAAGG - Intronic
1158791789 18:60788724-60788746 ATATATATGAAAAAATTATGAGG - Intergenic
1158795233 18:60838053-60838075 ATCTATTTGAAAATATTCCATGG + Intergenic
1159050716 18:63418910-63418932 ATATGTATGCAAATATTCACCGG + Intronic
1159309673 18:66690674-66690696 ATATATGTTCCAAAATTGCATGG + Intergenic
1159460580 18:68717794-68717816 ATATGTATGCAAAATATACAAGG - Intronic
1159803898 18:72931299-72931321 ATATATATGTAAATATATCATGG + Intergenic
1160302504 18:77696818-77696840 ATATATATGCGGAAATTCAAAGG - Intergenic
1162196753 19:8990723-8990745 ATATATATGCAAAAACTAGCTGG + Intergenic
1163239118 19:16048477-16048499 ATATATATACAAAAATTAGTTGG + Intergenic
1165850368 19:38846930-38846952 ATATATATGTAAAAATTAGCCGG + Intronic
1167150240 19:47704612-47704634 ATATATATACAAAAATTAGCTGG + Intergenic
1167475022 19:49695242-49695264 ATATATATGATAACATTACATGG + Intronic
1167659687 19:50789389-50789411 ATATATATACAAAAATTAGCCGG + Intergenic
1202660285 1_KI270708v1_random:63428-63450 ATATATATTTAAAAATTGCCAGG + Intergenic
1202668340 1_KI270709v1_random:20915-20937 CTGCATATTCAAAAATTCCATGG - Intergenic
925220877 2:2139475-2139497 ATATATATACAAAAATTAGCTGG + Intronic
925432866 2:3811404-3811426 ATAAATGTGCAAAAATCACAAGG - Intronic
926257981 2:11226466-11226488 ATATATATGCAAGAAGTAAATGG + Intronic
927041118 2:19231297-19231319 ATATATTTGCAACAATTTCTGGG - Intergenic
928639179 2:33279823-33279845 AAATATTTGCATACATTCCAAGG - Intronic
928968013 2:36996576-36996598 ATATATATACAAAAATTAGCCGG - Intronic
929292098 2:40204695-40204717 ATATATATGCAAAAAGATAAAGG + Intronic
929376506 2:41292739-41292761 ATATATATGTCAAATTTCAATGG - Intergenic
930667008 2:54109193-54109215 ATATATATGCACATATACCATGG + Intronic
932012077 2:67988690-67988712 ATATAGATGCAAACATTCAGCGG + Intergenic
932062371 2:68516795-68516817 ATATATATACAAATACACCATGG - Intronic
932648949 2:73534241-73534263 ATATAAACGTAAAAATTACAAGG - Intronic
932877544 2:75469557-75469579 GTATTTATTAAAAAATTCCATGG - Intronic
932890667 2:75594366-75594388 ATATGTATGTAAAAATTCGAAGG + Intergenic
933675766 2:85056077-85056099 ATATAAATACAAAGATTTCACGG - Exonic
934063974 2:88322330-88322352 ATAAATATGCAAATATCTCAAGG - Intergenic
934743430 2:96742408-96742430 ATATATATACAAAAATTAAATGG + Intergenic
936393866 2:112103042-112103064 TTATGTATGGAAAAATCCCAAGG + Intronic
938695238 2:133829086-133829108 ATAAATATTCAAAATTTCCTTGG - Intergenic
938997368 2:136694569-136694591 ATATATATGCAAAAAATAAATGG + Intergenic
939298555 2:140303103-140303125 ATATATATGCATAAAATAAATGG + Intronic
940339023 2:152559891-152559913 AGATAGATGCACAAAGTCCATGG - Intronic
940428896 2:153564181-153564203 ATATATATATAAAAAATCCATGG - Intergenic
940816096 2:158299339-158299361 ATGTATATGAAAATATTCCTTGG - Intronic
941394545 2:164957927-164957949 ATATATATGCAAAAATTCCAAGG + Intergenic
941940421 2:171031058-171031080 ATATATATGTAAAATTTTCTGGG - Intronic
942152717 2:173093251-173093273 ATAAATTTGGAAAAAATCCAGGG - Intronic
942158553 2:173157676-173157698 CTCTCTATGCAAAAATTACATGG - Intronic
942267086 2:174239233-174239255 ATATATGTACAAAATTTCAAAGG + Intronic
942581165 2:177418485-177418507 AAATAAATGCAAAAATCTCAAGG - Intronic
943008934 2:182423202-182423224 ATATATACCTAAAATTTCCAAGG + Intronic
943008938 2:182423267-182423289 ATATATACCTAAAATTTCCAAGG + Intronic
943028820 2:182661999-182662021 ATTTATATGAAAAAAATCAAAGG + Intergenic
943175031 2:184461460-184461482 ATCTATATGCAAAAATAGTATGG - Intergenic
943252494 2:185545987-185546009 ATATGTCTGCACAAATGCCACGG + Intergenic
943713074 2:191119681-191119703 ATATTTATATGAAAATTCCAAGG + Intronic
944396327 2:199271755-199271777 ATATATATATTAAAATTGCATGG - Exonic
945445778 2:209936613-209936635 ATATATATACACACATACCATGG - Intronic
946528330 2:220543851-220543873 TTAAAAATGCAAAAATTCCTTGG - Intergenic
946814039 2:223557690-223557712 ATATATATGCAAAAGTGGGATGG - Intergenic
946850055 2:223897337-223897359 ATATATATGCGAAATTTAGAGGG - Intronic
947022159 2:225691518-225691540 AGATATATGTAAAAAAGCCATGG + Intergenic
947047715 2:226006819-226006841 AAATTTATGTAAACATTCCAGGG - Intergenic
947088741 2:226485810-226485832 ATATATATGAAATATTTCAAAGG - Intergenic
947164656 2:227249567-227249589 AATTATATGTAAAAATTCCTGGG + Intronic
947200715 2:227612424-227612446 ATATATATACAAAAATTAGCTGG - Intronic
947954154 2:234173234-234173256 TTGTATAAGCAAAATTTCCATGG + Intergenic
948686299 2:239671881-239671903 ATATTTATGCAAAAATAAAAAGG + Intergenic
948898301 2:240939804-240939826 ATATATGTCCAAATAATCCACGG - Intronic
1168777286 20:458472-458494 ATATATACGCAAAAATTAGCTGG - Intronic
1168919886 20:1522642-1522664 ATATATATTAAAAACCTCCACGG - Intergenic
1169377232 20:5075945-5075967 ATATATATACAAAAATTAGCTGG + Intronic
1170683881 20:18551379-18551401 ATAAATATACAAATACTCCAGGG - Intronic
1170778959 20:19406305-19406327 ATATACATACAAAAATTCTTAGG - Intronic
1170975936 20:21164754-21164776 AACTATATGCCAAAACTCCAAGG - Intronic
1171516718 20:25744253-25744275 ATATATATCCAATAATTTGAAGG - Intergenic
1173436661 20:43039105-43039127 ATAAAAATGCAAAAATGCCTGGG + Intronic
1173699244 20:45053119-45053141 ATATGTATCCAAAATTGCCAGGG + Intronic
1174769683 20:53287224-53287246 ATATTTATTGAAAAATTACATGG + Intronic
1174995317 20:55560723-55560745 ACATATATGAAGAAATTCCCGGG + Intergenic
1176627726 21:9107582-9107604 ATATATATTTAAAAATTGCCAGG - Intergenic
1176646248 21:9353508-9353530 ATATATATTTAAAAATTGCCGGG + Intergenic
1176699498 21:10026577-10026599 ATATATATGCAGAAATACAAAGG + Intergenic
1177614076 21:23493367-23493389 ATATATACTTAAATATTCCAAGG - Intergenic
1177739258 21:25134252-25134274 ATGTATATGCAAACATTCTGTGG + Intergenic
1178293605 21:31389801-31389823 ATTTATATAGAAAAATACCAGGG - Intronic
1178569362 21:33721021-33721043 CTTTATATGCATAACTTCCAAGG + Intronic
1179145859 21:38766768-38766790 ATATATATACAAAAATTAGCTGG + Intergenic
1179310110 21:40187757-40187779 ATACATATTCAAAATTTCCTGGG + Intronic
1179332884 21:40422478-40422500 ATATATATACAAAAATTAGCCGG + Intronic
1180327769 22:11447018-11447040 ATATATATTTAAAAATTGCCAGG + Intergenic
1180379419 22:12125706-12125728 ATATATATTTAAAAATTGCCGGG + Intergenic
1180418069 22:12787177-12787199 ATATATATTTAAAAATTGCCGGG - Intergenic
1181453851 22:23042971-23042993 ATATATATTCCAAAATTATATGG - Intergenic
1182175525 22:28282905-28282927 ATATATATACATATATTCCCTGG + Intronic
1182834305 22:33329282-33329304 ATATACATTCAAAAATTCATTGG + Intronic
1183918644 22:41145605-41145627 ATATAAATACATAAATTCTAAGG - Intronic
1183947806 22:41336680-41336702 ATATATATTCAAAAATTAGCTGG + Intronic
949185170 3:1182073-1182095 ATATATATTGAATAATTTCAAGG + Intronic
949225598 3:1690349-1690371 ATATACAACCAAAAATTCCATGG + Intergenic
949258009 3:2073016-2073038 ATATATCTTCAATAATTGCAGGG + Intergenic
950117847 3:10462990-10463012 ACATATATGCAAAAGTTGGAAGG - Intronic
950764704 3:15265208-15265230 ATATATATACAAAACCTCCAGGG + Intronic
951091199 3:18575900-18575922 TTCTATATGCAAAAACTGCATGG + Intergenic
951595033 3:24309162-24309184 ATACATATACAAAAAGGCCAAGG - Intronic
951841650 3:27040443-27040465 ATATATATTCCAAAATTGTATGG - Intergenic
951940482 3:28072587-28072609 TTAAAAATGCAAAAATCCCAGGG - Intergenic
952553514 3:34505613-34505635 ATATATATACATAAATACAATGG - Intergenic
953220386 3:40965434-40965456 ACATATATGCAAAAATTCTCAGG - Intergenic
953233484 3:41085251-41085273 AAATAAATGCAAAAATTCGCTGG + Intergenic
954723358 3:52585141-52585163 ATATTGATGCAAAAATTACTTGG - Intronic
954827617 3:53388484-53388506 ATTTTTATGCAAAAATTAAAGGG + Intergenic
955162282 3:56475996-56476018 ATATACATTCAAAAATCCAAGGG - Intergenic
955598477 3:60618187-60618209 ATATATATGTAATAATTCTTTGG + Intronic
955676943 3:61458678-61458700 AGATAGATGCAAAAATGCCAAGG + Intergenic
955730260 3:61977495-61977517 GTATATACACAAAAATTACAAGG - Intronic
955928321 3:64029968-64029990 CTATAAAAGCAAAAATTCAAAGG + Intergenic
956504675 3:69925069-69925091 ATGTGAAAGCAAAAATTCCAAGG + Intronic
956832823 3:73070095-73070117 ATATATATACAAAAATGAGACGG - Intergenic
956928034 3:74010398-74010420 ATATATATGAAAGACATCCAGGG + Intergenic
956976378 3:74585362-74585384 ATATATAAGCCCAAACTCCATGG + Intergenic
957093932 3:75759862-75759884 ATATATATTTAAAAATTGCCGGG - Intronic
957392200 3:79590759-79590781 ATGTATATACATAAATTTCATGG + Intronic
957771602 3:84700339-84700361 AAATATATGCTAGAATTCAAAGG - Intergenic
958592284 3:96173379-96173401 ATATATATTCTAAAATTGTATGG + Intergenic
958939580 3:100295890-100295912 ACATATATGAAGAAATGCCAAGG - Intronic
959625984 3:108451742-108451764 ATATTGATGCAAAAATCTCATGG + Intronic
959764092 3:110002942-110002964 TAATATATGCTAAAATTCCTGGG - Intergenic
959814204 3:110656386-110656408 ACATATAAATAAAAATTCCAAGG + Intergenic
960307275 3:116076830-116076852 ACATAAATGCAAAAATTGAAAGG - Intronic
960419872 3:117431177-117431199 ACATATTTGAATAAATTCCATGG + Intergenic
960667666 3:120125877-120125899 ATCTATCTGGAAATATTCCAAGG + Intergenic
960762260 3:121085492-121085514 ATAAATGTGCAAAAATCACAGGG + Intronic
961146790 3:124600630-124600652 ATATATATATATAAATTTCATGG - Intronic
961715021 3:128852127-128852149 ATATATATATAATTATTCCATGG - Intergenic
961764088 3:129194636-129194658 ATATATATACAAAAATTAGCTGG + Intergenic
962517859 3:136170189-136170211 ATATATATACAAAAATTAGCTGG + Intronic
963219041 3:142785804-142785826 ATATATCTGCAAAAGTTCATAGG - Intronic
963447710 3:145436544-145436566 ATATAAATGAAAACATTGCAGGG + Intergenic
963865723 3:150358789-150358811 ATATATATACAAAAATTAGCTGG - Intergenic
964585686 3:158297933-158297955 ATACATATGAAAAAATTACAAGG + Intronic
965192049 3:165544128-165544150 ATATATATACAAATATGCCTGGG + Intergenic
965775493 3:172225970-172225992 ATATGTATGCCAAATTTACATGG - Intronic
965817013 3:172647371-172647393 AAATATATGCAACCATTCAAAGG - Intronic
966090542 3:176129977-176129999 CTAAATATGCAAAAATTAGATGG + Intergenic
966334139 3:178849740-178849762 ATTGATTTGCAAAAATCCCATGG + Intergenic
966575026 3:181491180-181491202 TTATATATGCCAAAGCTCCATGG - Intergenic
966665650 3:182468005-182468027 ATATCTATACAAACATACCATGG - Intergenic
966686850 3:182705007-182705029 TTCTATAAACAAAAATTCCATGG - Intergenic
966791104 3:183670346-183670368 GCTTATATGCAAAAAATCCATGG - Intronic
1202740634 3_GL000221v1_random:51549-51571 ATATATATTTAAAAATTGCCGGG - Intergenic
970215898 4:13760161-13760183 ATATATATACATAAATGGCAGGG + Intergenic
971414584 4:26412567-26412589 GTATAAATGCAAACAATCCAAGG + Intronic
971517036 4:27500120-27500142 ATTAATGTGCAAAAATTACAAGG + Intergenic
971568267 4:28173733-28173755 ATAAATAAGCAGATATTCCAGGG + Intergenic
971647183 4:29222234-29222256 ATCTATATGAAAAATTTACAGGG + Intergenic
972472190 4:39417045-39417067 ATATAGAAGCAAAATCTCCAAGG + Intronic
972478452 4:39475217-39475239 ATATATATACAAAAATTAGCCGG + Intronic
972648347 4:40991516-40991538 ATATGTATCCAAAAAGTACAGGG + Intronic
972907161 4:43764717-43764739 ATATATAAGGAAAAATGGCATGG - Intergenic
973029717 4:45321989-45322011 ATATTAATGAAAAAATACCAAGG - Intergenic
973363719 4:49190113-49190135 ATATATATTTAAAAATTGCTGGG + Intergenic
973397361 4:49606628-49606650 ATATATATTTAAAAATTGCCAGG - Intergenic
973922410 4:55701431-55701453 ATATATATGCAGAAATGGCATGG - Intergenic
973988692 4:56381414-56381436 ATATATATACAAAAATTAGCCGG + Intronic
974528004 4:63070337-63070359 ATAAAAATTTAAAAATTCCATGG + Intergenic
974678680 4:65132668-65132690 AAATATTTGGAAAAATTACATGG - Intergenic
975080253 4:70269033-70269055 ATATATATGCAAACATTTATGGG + Intergenic
975782932 4:77858719-77858741 GTATAAATGCAAATATTTCATGG + Intergenic
975798953 4:78038638-78038660 AAATTTATGCAAAAATACAAAGG - Intergenic
976522541 4:86045790-86045812 GGGTATATGCAAAAATCCCAGGG - Intronic
976930122 4:90556384-90556406 ATATATATACTAAAATACCTAGG + Intronic
977203000 4:94139038-94139060 AAATGTATGCAAAAATGCAAAGG + Intergenic
977594401 4:98862971-98862993 ATATACATACAAAAATTACCTGG + Intergenic
977752238 4:100623315-100623337 ATATATGTTCAAAAATTGTATGG - Intronic
978376964 4:108084353-108084375 ATATACAAGCACATATTCCAAGG + Intronic
978475471 4:109123732-109123754 ATATATATGCAATTATTCTAAGG + Intronic
978976867 4:114887926-114887948 ATTTAAATGCAAAAATTATAAGG - Intronic
979143538 4:117210193-117210215 ATATATTTTAAACAATTCCAGGG + Intergenic
979143543 4:117210272-117210294 ATATATTTTAAACAATTCCAGGG + Intergenic
979189596 4:117839998-117840020 ATATATATACAAAAATTAGCTGG - Intergenic
979215583 4:118160121-118160143 ATAAAAATGCCAAAATTCAAAGG + Intronic
979446755 4:120822721-120822743 ATATATATTAGAAAATTTCATGG + Intronic
979687832 4:123530065-123530087 TTATATTAGAAAAAATTCCATGG + Intergenic
979922746 4:126522020-126522042 TTATATGTGCAAGAATTCCATGG - Intergenic
979969757 4:127119826-127119848 ATATATATTCAAAAATTGGCTGG - Intergenic
980280269 4:130709027-130709049 ACATATATGCCAAGATTGCAAGG - Intergenic
980371908 4:131885212-131885234 ATAAATATGCAGAAATACAAAGG + Intergenic
980407735 4:132375307-132375329 TTATATGTGCAAAAATATCAGGG + Intergenic
980750801 4:137085253-137085275 ATATGTATGAAAAACATCCATGG - Intergenic
980888371 4:138787597-138787619 ATATATATTTAAAAATTCAAAGG + Intergenic
981232649 4:142375713-142375735 AGATAAATGCAAAAGTTCTAAGG - Intronic
981342098 4:143633423-143633445 ATATTTATGCAATAATTGAATGG - Intronic
981792324 4:148552557-148552579 ATATTTATGCAAAAATACACAGG - Intergenic
982046532 4:151452872-151452894 ATAAATATGCCAAAATTTAATGG - Intronic
982338935 4:154273239-154273261 ATATATATGCACACACACCATGG + Intronic
982361055 4:154519579-154519601 ATATATTTACAACAATCCCAAGG - Intergenic
982399440 4:154950409-154950431 ATATATATTCCAAAATTATATGG - Intergenic
982867739 4:160539087-160539109 ATTAATATGCAAAAATACAATGG - Intergenic
983050004 4:163034963-163034985 ATATATATGACAAAATTGAAAGG - Intergenic
983069018 4:163247407-163247429 ATATATAGGCAAGAAATCAAGGG - Intergenic
983081758 4:163394140-163394162 ATATACATGCTAAGTTTCCAAGG - Intergenic
983148645 4:164248317-164248339 AAATATATGCACCAATCCCAAGG + Intronic
983585622 4:169351300-169351322 ATACTTATGCTATAATTCCAGGG + Intergenic
983767012 4:171496781-171496803 ATCTATATTTAAAATTTCCAAGG + Intergenic
983924309 4:173381621-173381643 CTATATATAGAAAAATCCCATGG - Intergenic
984100312 4:175476565-175476587 AAATATAAGTAAAAAGTCCAAGG + Intergenic
984178544 4:176451426-176451448 ATATATATTCAAAAATACTGTGG - Intergenic
984544029 4:181077460-181077482 ATTTATATAGCAAAATTCCATGG - Intergenic
984722200 4:182984578-182984600 ATATATATTCAACAATTTCTGGG - Intergenic
985378950 4:189372201-189372223 ATATATTTGCAAAAATTCTGTGG - Intergenic
985387600 4:189463643-189463665 ATATAGAAGCAGTAATTCCACGG + Intergenic
1202761040 4_GL000008v2_random:111192-111214 ATATATATTTAAAAATTGCCGGG + Intergenic
986095138 5:4547204-4547226 ATATGTGTGCAAAAATGCCCAGG - Intergenic
986379450 5:7168679-7168701 GTATTTCTGCTAAAATTCCAAGG + Intergenic
986582629 5:9281322-9281344 AAATATATACAAAAATTATAGGG - Intronic
987209169 5:15661078-15661100 AGATATATGGAAAAATTACATGG - Intronic
987479443 5:18434257-18434279 ATATATATGTAAAATTTTCCCGG + Intergenic
987615033 5:20262473-20262495 ATACATATGCATAAATTCTAAGG + Intronic
987841950 5:23233577-23233599 ATATATATTCTAAAATTGTATGG - Intergenic
988005539 5:25405773-25405795 CTATATATGAAAAAATTTAATGG - Intergenic
988431434 5:31123479-31123501 ATATATAAGCAAAATTAGCAAGG + Intergenic
989114548 5:37939761-37939783 CCATATATTCACAAATTCCAGGG + Intergenic
989281890 5:39654034-39654056 ATATATGTTCAAAAATTGAATGG + Intergenic
990103484 5:52223545-52223567 ATATAAATGCAAAAATTCAATGG + Intergenic
990266607 5:54083895-54083917 ATACATATGCTAAAATTAAATGG + Intronic
990812025 5:59737390-59737412 ATTTCTAGGCAAAAATTTCAGGG - Intronic
991485529 5:67131897-67131919 ATAATTATGTAAATATTCCAAGG - Exonic
991541619 5:67736222-67736244 ACATATATACCAAAAGTCCATGG + Intergenic
993440905 5:87955627-87955649 ATATATACGCAAAAAGCCTATGG + Intergenic
993702239 5:91132295-91132317 AAATTTATAAAAAAATTCCAAGG - Intronic
993745333 5:91590247-91590269 ATATATATTCCAAAATTATATGG - Intergenic
993803335 5:92373132-92373154 AAATATATACAAATATTGCAAGG + Intergenic
993961442 5:94301726-94301748 TAATATATGCAAAAATGACAAGG + Intronic
993987048 5:94610007-94610029 ATATATCTGAAAAAATTTAAAGG + Intronic
994531588 5:100979405-100979427 ATATGTTTTTAAAAATTCCAGGG - Intergenic
994552171 5:101249578-101249600 ATACATATGCAAAAATCCTTAGG + Intergenic
995393739 5:111666016-111666038 ATATATATTCCAAAATTGCATGG - Intronic
996751141 5:126890064-126890086 AAAGATATCCAAAAAGTCCAGGG - Intronic
996794625 5:127331587-127331609 ATATATATGCTATAAGACCAAGG - Intronic
996911130 5:128658197-128658219 AAATATATGCAAAAATCCCTAGG + Intronic
997063579 5:130536729-130536751 ATATCTATGCAAACATAACAAGG - Intergenic
997776290 5:136609811-136609833 ATAGATTTGCAAATTTTCCAAGG - Intergenic
997837422 5:137207032-137207054 ATATTTATGTACACATTCCAGGG - Intronic
998539148 5:142963159-142963181 ATATATATACATATATACCATGG - Intronic
998634704 5:143940493-143940515 TAATATATTCACAAATTCCAGGG - Intergenic
998685581 5:144520618-144520640 AATTATATGCAGAAATTCCTAGG - Intergenic
998693164 5:144610616-144610638 ATTTATATGCAACAATGGCATGG - Intergenic
999780496 5:154845945-154845967 ATATATATACAAAAATTAGCTGG - Intronic
1000341795 5:160282960-160282982 ATATATATATATATATTCCAAGG - Intronic
1000375891 5:160581830-160581852 ATATATATGCACCAAATACAGGG - Intronic
1001223095 5:169919788-169919810 ATTAATATGCAAATACTCCAGGG - Intronic
1001248658 5:170126530-170126552 AGTGATATTCAAAAATTCCATGG - Intergenic
1003029593 6:2590114-2590136 AAATATATGAAAAAATGCCTGGG - Intergenic
1003056478 6:2825290-2825312 ATATATATACAAAAATTAGCTGG + Intergenic
1003828893 6:9983601-9983623 TTAGATATGCTACAATTCCAAGG - Intronic
1004055772 6:12137024-12137046 ATATATAGGTAAAAATTCAAAGG + Intronic
1004082945 6:12413575-12413597 AAATATTTGGAGAAATTCCAAGG - Intergenic
1004385415 6:15168630-15168652 ATATATATACAAAAATTAGCTGG + Intergenic
1004439681 6:15637294-15637316 AAATAAATACAAAAATTTCAGGG - Intronic
1004937779 6:20524929-20524951 AAATAATTGGAAAAATTCCAGGG + Intergenic
1005181354 6:23110636-23110658 ATATATGTTCCAAAATTGCATGG - Intergenic
1005532892 6:26725335-26725357 ACATAAAAGCAAAAATTGCAAGG + Intergenic
1005535559 6:26752658-26752680 ACATAAAAGCAAAAATTACATGG - Intergenic
1005537903 6:26776329-26776351 ACATAAAAGCAAAAATTGCAAGG - Intergenic
1005606455 6:27482970-27482992 ATTTAAATGCAAAAAGTACAAGG + Intergenic
1005805337 6:29469051-29469073 ATGTATATCCAATAATTCTAAGG + Intergenic
1008055277 6:46939180-46939202 ACATAAAAGCAAAAATCCCAGGG + Intronic
1008156463 6:48020815-48020837 ATATATATATAAATATTCAAGGG + Intronic
1009006598 6:57796283-57796305 ACATAGAAGCAAAAATTGCATGG - Intergenic
1009008771 6:57818735-57818757 ACATAGAAGCAAAAATTGCATGG - Intergenic
1009337469 6:62510046-62510068 ATATGTATGTAAAAATCCCCAGG - Intergenic
1009560761 6:65239945-65239967 ATATATATGCTACAAATACATGG - Intronic
1009735476 6:67671505-67671527 ATATATATTCCAAAATTGCATGG - Intergenic
1009795871 6:68466563-68466585 TTATTTATGCAAAAAACCCATGG - Intergenic
1010073914 6:71778780-71778802 ATATGTATACAAAAATTTCCAGG - Intergenic
1010350425 6:74867551-74867573 CTAAATATGCCAAAATTCAAGGG + Intergenic
1010471234 6:76230660-76230682 AGAAATATGGAAAAATTTCAGGG - Intergenic
1010523164 6:76866756-76866778 ATTTATTTGAAAAGATTCCATGG + Intergenic
1010567711 6:77437328-77437350 AAATATCAGCAAAAATTGCATGG + Intergenic
1010632315 6:78212901-78212923 AAATATTTGAAAATATTCCAAGG - Intergenic
1010776873 6:79896983-79897005 AAATTATTGCAAAAATTCCATGG + Intergenic
1010802970 6:80199397-80199419 ATATATAATAAAAAAGTCCATGG + Intronic
1010891929 6:81323760-81323782 ATAGATATGCCAAAATTAAAAGG + Intergenic
1011133516 6:84075429-84075451 ATACAAAAGCAAATATTCCATGG - Intronic
1011176719 6:84569896-84569918 ATAGATATACAAAAATTAAATGG + Intergenic
1011265850 6:85518190-85518212 ATATTTATTGAAAATTTCCATGG - Intronic
1011977185 6:93317451-93317473 ATTCATATGTAAAAATACCAAGG - Intronic
1012103610 6:95124178-95124200 ACATATGTGCAAAGATTCAAAGG + Intergenic
1012333927 6:98030200-98030222 AAATAAATGAAAAAAATCCAAGG - Intergenic
1012695239 6:102373323-102373345 ATATTTATACAAATATTACAGGG + Intergenic
1012825602 6:104142521-104142543 ATATATATCTAGAAATCCCAAGG + Intergenic
1012870724 6:104670323-104670345 ATAAATATTTAAAAATCCCATGG + Intergenic
1013376916 6:109526373-109526395 AAATATATTCAAATAATCCAAGG + Intronic
1013620383 6:111882381-111882403 ATATATATGTGAAAATACCTGGG + Intergenic
1013639531 6:112059648-112059670 ACATATATGCACAGACTCCAGGG + Intronic
1014018271 6:116559659-116559681 GTATAGATGAAAAAAATCCAGGG - Intergenic
1014054347 6:116996570-116996592 ATTTATATATAAAAATTGCATGG - Intergenic
1014411772 6:121132900-121132922 ATACATATGTAAAAATTCAAAGG + Intronic
1014942601 6:127460758-127460780 ATCTCTATGACAAAATTCCATGG - Intronic
1015511940 6:134046647-134046669 ATATATATACAAAAATTAGCCGG + Intronic
1015932076 6:138371245-138371267 TTATATATGCAAAAAATAAAGGG - Intergenic
1016098606 6:140068981-140069003 TTAAATATGGAAAATTTCCAAGG - Intergenic
1016117572 6:140306244-140306266 ATGAATATGCAATTATTCCAGGG - Intergenic
1016128684 6:140437969-140437991 AAAAATATGCAAAAGTACCAGGG + Intergenic
1016138570 6:140579605-140579627 AAATATGTGAAAATATTCCAGGG + Intergenic
1016190121 6:141254862-141254884 ATATATATGCATTAAATCAAGGG + Intergenic
1016408283 6:143755010-143755032 ATATATATGCAAATAATGAACGG - Intronic
1016603652 6:145892218-145892240 TTATATATGCAAAAATACAATGG - Intronic
1016905171 6:149141463-149141485 ATATACATGAAAAAATTCTAGGG + Intergenic
1017626518 6:156354853-156354875 TTATATATCCAAAAGTTACAAGG - Intergenic
1019909527 7:4091086-4091108 GTTTATATGCAAAAATTTTAAGG - Intronic
1020376469 7:7492935-7492957 ACATATATATATAAATTCCATGG - Intronic
1020808506 7:12821684-12821706 ATATATAAGAAATAATTCCAAGG + Intergenic
1020908884 7:14102999-14103021 ATATATATGGAAAAACTATAAGG - Intergenic
1020999849 7:15315298-15315320 AGATATAAGCAAAACTTACATGG + Intronic
1021868557 7:24981153-24981175 ATATCTATGCAAAAAATAAAAGG + Intronic
1021891603 7:25191351-25191373 ATATATATTCCAAAATTGTATGG - Intergenic
1022190656 7:28014104-28014126 AAATAGATGCTAAAATTACATGG + Intronic
1022216871 7:28271803-28271825 ATTTAAATGCAAAAATTCATCGG - Intergenic
1022965786 7:35470020-35470042 ATATATATGCGAAATTTCCCAGG + Intergenic
1022982437 7:35617175-35617197 AACTAAAAGCAAAAATTCCAAGG - Intergenic
1022982850 7:35620714-35620736 TTATAAATACAAAAATTCCCTGG + Intergenic
1023945992 7:44803688-44803710 TTAAATATGCAAAAATTACATGG + Intronic
1024000831 7:45188448-45188470 ATATATCAGAAGAAATTCCATGG - Intergenic
1024096169 7:45984589-45984611 GGATATATGCAAGATTTCCAGGG - Intergenic
1024102853 7:46050592-46050614 ATAAATAGGAAAAAATTGCAGGG - Intergenic
1024370094 7:48572806-48572828 ACATCTATGTAAAAATTACATGG - Intronic
1027470910 7:78573177-78573199 ATATATATATAAAAGTTCCAGGG - Intronic
1027722699 7:81765277-81765299 AAATACAATCAAAAATTCCACGG - Intronic
1027893726 7:84013549-84013571 ATATTTATTCAAAACTTGCAAGG + Intronic
1028322613 7:89478961-89478983 ATTTATATACAAAAAATACAAGG - Intergenic
1028766827 7:94569395-94569417 ATTTATAGGGAAAAATCCCAAGG + Intergenic
1028932536 7:96429010-96429032 ATATATTTGAAAACACTCCAGGG + Intergenic
1029343938 7:99965281-99965303 ATATAAATGCAAATATCACAGGG - Intergenic
1029375145 7:100172624-100172646 ATATATATACAAAAATTAGCCGG - Intronic
1029564701 7:101328530-101328552 ATATATATACAAAAATTAGTCGG - Intergenic
1029901503 7:104045642-104045664 ATATATATGCAGCCATCCCATGG + Intergenic
1030109606 7:106015609-106015631 AGGCATATGCAAAAATGCCAAGG - Intronic
1030207418 7:106964341-106964363 CTAAATTTGCAAAAATTCCCAGG - Intergenic
1030450585 7:109705246-109705268 ATATATATGTCACAATTCAATGG - Intergenic
1030527085 7:110667290-110667312 ATATATATTCAAAAATAAAATGG - Intronic
1030645035 7:112051375-112051397 ATGTATATGCAGAAATTTTAAGG - Intronic
1030813645 7:114006972-114006994 ATATAGATGCACAAATTCAAAGG - Intronic
1030827927 7:114184766-114184788 ATATATATGCAAAACTGCCAAGG + Intronic
1030997775 7:116378970-116378992 ATATATATGCACACATTACTTGG - Intronic
1031297446 7:120019911-120019933 ATAAATATGGAAAAATTAAATGG - Intergenic
1032396814 7:131596287-131596309 ATATATATGCAAATATTCATGGG - Intergenic
1032853817 7:135817541-135817563 ATATATATACAAAACCTCCGTGG - Intergenic
1032873692 7:136013649-136013671 TTCTATATGCAAAAATTAGATGG - Intergenic
1033949675 7:146768661-146768683 TTATATTAGGAAAAATTCCATGG - Intronic
1036395351 8:8365816-8365838 ATATATATACAAAAATTAGCTGG + Intronic
1036675449 8:10828216-10828238 ATGTCTTTGCAAAAAATCCAAGG - Intronic
1037116132 8:15230338-15230360 ATACATAGGCCAAAATTCCAGGG - Intronic
1038169710 8:25118947-25118969 ATATATATTCAATAATTCAATGG - Intergenic
1040137012 8:43866412-43866434 ATATATATGCACACAATACAGGG - Intergenic
1040536352 8:48314554-48314576 TTAGATATGAAAAAATTCCGAGG + Intergenic
1040815452 8:51503590-51503612 ATAGATATCCAAAAATGGCAGGG - Intronic
1041071227 8:54127747-54127769 ATATATATACAAAAATTAGCTGG + Intergenic
1041921024 8:63181084-63181106 ATTTATATGCACAAATTACATGG - Intronic
1041946560 8:63450207-63450229 ATATATATATATATATTCCAAGG - Intergenic
1042047958 8:64675340-64675362 AAATATAAATAAAAATTCCAGGG - Intronic
1042267049 8:66919738-66919760 ATACGTATGGAAAACTTCCAAGG - Exonic
1042767517 8:72341514-72341536 ATTTATATGAAAAAATTGCAAGG + Intergenic
1043196524 8:77299758-77299780 ATATATATGTATAAATTCTGGGG + Intergenic
1043330654 8:79114393-79114415 ATATATATGCAACCAATACAGGG + Intergenic
1043534001 8:81180460-81180482 ATATAAATGCAATAATTCCAAGG - Intergenic
1043977018 8:86594868-86594890 ATATATATACAAAAATTAGCTGG - Intronic
1044069954 8:87746811-87746833 ATATAAATGCAAATATATCAGGG - Intergenic
1044310074 8:90683420-90683442 ATATATGTTCCAAAATTACATGG + Intronic
1044521993 8:93209452-93209474 AAATGTATGCATAAATTACAGGG - Intergenic
1044589011 8:93895764-93895786 ATCAATATGCAAATATTCCCAGG + Intronic
1044762240 8:95533149-95533171 ATATAGATGCAAACATTCTACGG + Intergenic
1044856428 8:96480870-96480892 CTATAAATGCAAACATTCCTTGG + Intergenic
1045240599 8:100397424-100397446 ATATATATGCAAACACTGAAAGG - Intronic
1045764618 8:105651960-105651982 GTATATATGCAACATTTCAAAGG - Intronic
1045877120 8:106994811-106994833 ATATATACATATAAATTCCATGG + Intergenic
1046118662 8:109817106-109817128 ATATTTATGCACAAAATACAAGG - Intergenic
1046448111 8:114350387-114350409 ATATGTATGAAATAACTCCATGG + Intergenic
1046647268 8:116799860-116799882 ATATAAAAGCAAAAATACCAGGG + Intronic
1046790640 8:118318348-118318370 ATATATATACATATATACCATGG + Intronic
1046898393 8:119497730-119497752 ATATATATGGAATAAATACACGG + Intergenic
1046988937 8:120427433-120427455 ACATATATGAAAAAAATCAATGG + Intronic
1048631688 8:136249634-136249656 AAATATATTCACAATTTCCAGGG - Intergenic
1048906205 8:139091880-139091902 AGATAGAGGAAAAAATTCCAAGG + Intergenic
1050039862 9:1477853-1477875 ATATAAATACATAAATTCAAGGG + Intergenic
1050203139 9:3169975-3169997 ATTTACATGAAACAATTCCATGG + Intergenic
1050312647 9:4369124-4369146 AATAATGTGCAAAAATTCCAAGG - Intergenic
1050832502 9:10031063-10031085 AAAAATATGGACAAATTCCAGGG + Intronic
1050975541 9:11933245-11933267 ATATATATACACACATACCATGG + Intergenic
1051219666 9:14834772-14834794 ATATATGTTCAAAAATTGTATGG + Intronic
1051440496 9:17077834-17077856 ATATATAGCAAAAAATGCCATGG + Intergenic
1051951613 9:22641313-22641335 ATATACATGCAATAATTTCATGG - Intergenic
1052150633 9:25110893-25110915 ATACATGTTCAAAAATTCTAGGG + Intergenic
1052466228 9:28833217-28833239 ATATATATGGCAAAAGTCAAGGG - Intergenic
1052611662 9:30783786-30783808 ATAGATATGGCATAATTCCAAGG + Intergenic
1053042640 9:34887716-34887738 AGATATATGCAAAAAAATCAGGG - Intergenic
1053568997 9:39284728-39284750 AAAAATATGAAAAAATTTCAGGG - Intronic
1053769379 9:41451851-41451873 ATAAATATGCAGAAATACAAAGG - Intergenic
1053834963 9:42125775-42125797 AAAAATATGAAAAAATTTCAGGG - Intronic
1054090629 9:60843705-60843727 AAAAATATGAAAAAATTTCAGGG - Intergenic
1054112040 9:61119262-61119284 AAAAATATGAAAAAATTTCAGGG - Intergenic
1054128147 9:61334279-61334301 AAAAATATGAAAAAATTTCAGGG + Intergenic
1054317475 9:63609839-63609861 ATAAATATGCAGAAATACAAAGG + Intergenic
1054548047 9:66363354-66363376 ATAAATATGCAGAAATACAAAGG - Intergenic
1054595571 9:67061754-67061776 AAAAATATGAAAAAATTTCAGGG + Intergenic
1055322756 9:75098496-75098518 CTTTATATGCACAGATTCCAAGG + Intronic
1055503241 9:76922669-76922691 ATAATTATGCAATAATTCCAAGG - Intergenic
1055698426 9:78915293-78915315 ATATATAAGCAAAATTCCCCTGG - Intergenic
1056571391 9:87819332-87819354 ATATATCTGCACAAATGCCAGGG - Intergenic
1056599358 9:88034521-88034543 ATATATATACAAAAATTAGCCGG - Intergenic
1056809429 9:89752816-89752838 ATAATTATGCAAAAATTCTGTGG - Intergenic
1057348177 9:94270566-94270588 ATATATATGAAAAAATTCAATGG - Intronic
1058276981 9:103055538-103055560 AAAAATATTCAAAAATACCAGGG + Intergenic
1058720938 9:107763004-107763026 AAATATAGGCAAAAGTTGCATGG - Intergenic
1060191157 9:121593827-121593849 ATAAATATACAAAAATTACCTGG - Intronic
1060261675 9:122080530-122080552 ATATATATACAAAAATTAGCTGG + Intronic
1060470949 9:123947772-123947794 ATATATATGCATATATACCTGGG - Intergenic
1060633898 9:125184818-125184840 ATATATATACAAAAATTAGCTGG + Intronic
1060988388 9:127834232-127834254 ATATATATACAAAAATTAGCTGG - Intronic
1203750572 Un_GL000218v1:75261-75283 ATATATATTTAAAAATTGCCAGG - Intergenic
1203483423 Un_GL000224v1:29087-29109 ATATATATTTAAAAATTGCCAGG + Intergenic
1203401300 Un_KI270519v1:102317-102339 AGATAAATGCACACATTCCAAGG - Intergenic
1203709279 Un_KI270742v1:81484-81506 ATATATATTTAAAAATTGCCGGG - Intergenic
1203541810 Un_KI270743v1:96077-96099 ATATATATTTAAAAATTGCCGGG + Intergenic
1203582445 Un_KI270746v1:22904-22926 ATTGATATGCAAAACTTCTAGGG - Intergenic
1186023308 X:5281319-5281341 ATATATATACAAAAATTAGCTGG + Intergenic
1186049054 X:5569803-5569825 ATGTATATGCATAAATTTCCAGG - Intergenic
1186073874 X:5854819-5854841 ATATATATACAAAAATTACCTGG + Intronic
1186078943 X:5909448-5909470 ATATATACACAAAGATGCCATGG - Intronic
1186120236 X:6352982-6353004 ATATATATATAAAGATTCCCTGG + Intergenic
1186824264 X:13322684-13322706 AAATACCTGCAAAAATCCCATGG - Intergenic
1186844161 X:13514524-13514546 GTTTATCTGCATAAATTCCAGGG + Intergenic
1187025939 X:15435417-15435439 ATATATATGCAAACTTAACAGGG - Intronic
1187300786 X:18047625-18047647 ATACATAGGCAATAAATCCAAGG - Intergenic
1187340574 X:18417582-18417604 ATATATATACATATATTCCCTGG + Intergenic
1187622372 X:21072006-21072028 GTATATATGCTAAATTTGCAAGG - Intergenic
1188146780 X:26624160-26624182 ATATATTTGTAAAAATTTAAGGG - Intergenic
1188480238 X:30629987-30630009 ATACATATTCACAGATTCCAGGG - Intergenic
1189001508 X:36952479-36952501 ATATATGTTCAAAAATTGTATGG + Intergenic
1189379061 X:40488859-40488881 ATATGTTTGGAAAAATTCTAGGG - Intergenic
1189682380 X:43529882-43529904 TAATATATTCACAAATTCCAGGG - Intergenic
1189721287 X:43921604-43921626 ATATATATAAAAGAATTACACGG - Intergenic
1190722985 X:53166105-53166127 ATATATGTTCAAAAATTGTATGG + Intergenic
1190791609 X:53705870-53705892 TAATATATTCACAAATTCCAGGG - Intergenic
1191644872 X:63469399-63469421 ATATATATTCCAAAATTGTATGG - Intergenic
1192828201 X:74721127-74721149 ATATATAGCCAAATAGTCCATGG + Intergenic
1192975530 X:76279896-76279918 AGATATATGCAAAAATACTAAGG - Intergenic
1193528954 X:82630461-82630483 GTATATCTGAAAAAATCCCAAGG + Intergenic
1193621769 X:83761615-83761637 ACATAAATGCATAAATTTCAGGG - Intergenic
1193801657 X:85944402-85944424 ATATAAATGCACAAATTCCATGG + Intronic
1194131396 X:90086420-90086442 ATATATGTCCAAAAATTGTACGG - Intergenic
1194150456 X:90318732-90318754 AAATATATGAAAAAATAGCAGGG - Intergenic
1194589686 X:95784282-95784304 AAATATTTTCAAAAATTTCAGGG + Intergenic
1194596352 X:95863806-95863828 AAATATATCCAAAATTTCTAAGG + Intergenic
1195665709 X:107428549-107428571 AAATATTTACCAAAATTCCAAGG + Intergenic
1196347983 X:114689193-114689215 ATATATACGCATACATACCATGG - Intronic
1197027388 X:121770246-121770268 ATATATATACACACATACCATGG - Intergenic
1197651177 X:129066286-129066308 ATATATATACAAAAATTAGCTGG + Intergenic
1197934380 X:131725623-131725645 ATATATATTCCAAAATTGTATGG + Intergenic
1198855917 X:141016181-141016203 ATATATACACAAAAATTCGAAGG - Intergenic
1198876213 X:141229957-141229979 ATATATACACAAAAATTCGAAGG + Intergenic
1198906776 X:141571186-141571208 ATATATACACAAAAATTCGAAGG + Intergenic
1198917071 X:141684865-141684887 ATATATACACAAAAATTCAAAGG + Intronic
1198953163 X:142096344-142096366 ATATATAGGAAAAAATGGCATGG - Intergenic
1199773627 X:150991797-150991819 ATATAAGTGCAAAACTTACATGG + Intergenic
1199896019 X:152128457-152128479 ATATACATACAAAAATTTGAGGG - Intergenic
1199986530 X:152956384-152956406 ATATATATTCCAAAATTATATGG - Intronic
1200496819 Y:3895490-3895512 AAATATATGAAAAAATAGCAGGG - Intergenic
1201164228 Y:11192938-11192960 ATATATATTTAAAAATTGCCGGG - Intergenic
1201426554 Y:13857781-13857803 ATATATATGAAAAAATAACCAGG + Intergenic
1201864165 Y:18631561-18631583 ATATATATATATATATTCCAAGG - Intergenic
1201869157 Y:18688817-18688839 ATATATATATATATATTCCAAGG + Intergenic