ID: 941395565

View in Genome Browser
Species Human (GRCh38)
Location 2:164968911-164968933
Sequence TGGCGATCAGCAGTGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941395558_941395565 23 Left 941395558 2:164968865-164968887 CCTTCCAGATTCGGAGGAGTGGA No data
Right 941395565 2:164968911-164968933 TGGCGATCAGCAGTGGTGGACGG No data
941395559_941395565 19 Left 941395559 2:164968869-164968891 CCAGATTCGGAGGAGTGGAAGTC No data
Right 941395565 2:164968911-164968933 TGGCGATCAGCAGTGGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941395565 Original CRISPR TGGCGATCAGCAGTGGTGGA CGG Intergenic
No off target data available for this crispr