ID: 941396301

View in Genome Browser
Species Human (GRCh38)
Location 2:164977913-164977935
Sequence CTTTGTAAGGCCCAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941396294_941396301 16 Left 941396294 2:164977874-164977896 CCTGGCTGGACACAGTGGCTCAC 0: 18
1: 458
2: 1912
3: 5378
4: 9455
Right 941396301 2:164977913-164977935 CTTTGTAAGGCCCAGGTGGATGG No data
941396295_941396301 -8 Left 941396295 2:164977898-164977920 CCTATAATCCCAGCACTTTGTAA No data
Right 941396301 2:164977913-164977935 CTTTGTAAGGCCCAGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941396301 Original CRISPR CTTTGTAAGGCCCAGGTGGA TGG Intergenic
No off target data available for this crispr