ID: 941396869

View in Genome Browser
Species Human (GRCh38)
Location 2:164984081-164984103
Sequence GTGATGTTGATTTCAGACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941396869_941396875 22 Left 941396869 2:164984081-164984103 CCAGAGTCTGAAATCAACATCAC No data
Right 941396875 2:164984126-164984148 TAGGGCTGTCTTCCCTCTGGAGG No data
941396869_941396879 30 Left 941396869 2:164984081-164984103 CCAGAGTCTGAAATCAACATCAC No data
Right 941396879 2:164984134-164984156 TCTTCCCTCTGGAGGTTCGGGGG No data
941396869_941396876 27 Left 941396869 2:164984081-164984103 CCAGAGTCTGAAATCAACATCAC No data
Right 941396876 2:164984131-164984153 CTGTCTTCCCTCTGGAGGTTCGG No data
941396869_941396871 -7 Left 941396869 2:164984081-164984103 CCAGAGTCTGAAATCAACATCAC No data
Right 941396871 2:164984097-164984119 ACATCACTGGACTAAAATCAAGG No data
941396869_941396873 4 Left 941396869 2:164984081-164984103 CCAGAGTCTGAAATCAACATCAC No data
Right 941396873 2:164984108-164984130 CTAAAATCAAGGTGACAGTAGGG No data
941396869_941396872 3 Left 941396869 2:164984081-164984103 CCAGAGTCTGAAATCAACATCAC No data
Right 941396872 2:164984107-164984129 ACTAAAATCAAGGTGACAGTAGG No data
941396869_941396874 19 Left 941396869 2:164984081-164984103 CCAGAGTCTGAAATCAACATCAC No data
Right 941396874 2:164984123-164984145 CAGTAGGGCTGTCTTCCCTCTGG No data
941396869_941396878 29 Left 941396869 2:164984081-164984103 CCAGAGTCTGAAATCAACATCAC No data
Right 941396878 2:164984133-164984155 GTCTTCCCTCTGGAGGTTCGGGG No data
941396869_941396877 28 Left 941396869 2:164984081-164984103 CCAGAGTCTGAAATCAACATCAC No data
Right 941396877 2:164984132-164984154 TGTCTTCCCTCTGGAGGTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941396869 Original CRISPR GTGATGTTGATTTCAGACTC TGG (reversed) Intergenic
No off target data available for this crispr