ID: 941396873

View in Genome Browser
Species Human (GRCh38)
Location 2:164984108-164984130
Sequence CTAAAATCAAGGTGACAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941396869_941396873 4 Left 941396869 2:164984081-164984103 CCAGAGTCTGAAATCAACATCAC No data
Right 941396873 2:164984108-164984130 CTAAAATCAAGGTGACAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941396873 Original CRISPR CTAAAATCAAGGTGACAGTA GGG Intergenic
No off target data available for this crispr