ID: 941399808

View in Genome Browser
Species Human (GRCh38)
Location 2:165016832-165016854
Sequence GACTCAATCACTGTGCAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941399808_941399812 13 Left 941399808 2:165016832-165016854 CCCATCTGCACAGTGATTGAGTC No data
Right 941399812 2:165016868-165016890 ATTCCTGGAATCTGTGAGAAAGG No data
941399808_941399810 -2 Left 941399808 2:165016832-165016854 CCCATCTGCACAGTGATTGAGTC No data
Right 941399810 2:165016853-165016875 TCACAACAAATCCAGATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941399808 Original CRISPR GACTCAATCACTGTGCAGAT GGG (reversed) Intergenic
No off target data available for this crispr