ID: 941405631

View in Genome Browser
Species Human (GRCh38)
Location 2:165084076-165084098
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941405631_941405633 8 Left 941405631 2:165084076-165084098 CCTGGTTCACTCTGTTAAACTTT No data
Right 941405633 2:165084107-165084129 CTGAAGTTTTGCTTGCGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941405631 Original CRISPR AAAGTTTAACAGAGTGAACC AGG (reversed) Intergenic
No off target data available for this crispr