ID: 941405769

View in Genome Browser
Species Human (GRCh38)
Location 2:165085385-165085407
Sequence AAGAGTAAACAATAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 543
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 497}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941405769_941405772 -2 Left 941405769 2:165085385-165085407 CCTTCCTCCTATTGTTTACTCTT 0: 1
1: 0
2: 3
3: 42
4: 497
Right 941405772 2:165085406-165085428 TTTTTGATTCATCTTGCCAGAGG 0: 1
1: 0
2: 4
3: 68
4: 680

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941405769 Original CRISPR AAGAGTAAACAATAGGAGGA AGG (reversed) Intergenic
900867919 1:5281889-5281911 AAGAGTAAAGAATATGAAGTTGG + Intergenic
902278763 1:15359174-15359196 AAGAGGAGACAAGAGGAGTAAGG + Intronic
904041111 1:27585784-27585806 AAGAGTTAACAGTTGGAGGAAGG - Intronic
905543062 1:38775467-38775489 TAGGGTAAAGAAGAGGAGGAAGG - Intergenic
905759230 1:40539957-40539979 AAAATTCAACAATAGGGGGAGGG - Intronic
905785104 1:40749216-40749238 AAGGAGAAACAATATGAGGAAGG - Intronic
906042379 1:42797998-42798020 AAAAGTAAAGAATGGGAGGGTGG + Intergenic
906358999 1:45136671-45136693 AAGAGTAAATTTTTGGAGGAAGG - Intronic
906472097 1:46139671-46139693 AAGAGGAAAGACGAGGAGGATGG - Intronic
908097793 1:60758503-60758525 AGGACTAAAAAATAGGAAGAAGG - Intergenic
908267593 1:62394637-62394659 TAGTGTAGACAATGGGAGGAAGG + Intergenic
908698301 1:66869987-66870009 AAAAGAAAACATTAGGAGTAAGG + Intronic
908745754 1:67375096-67375118 AAAAGTACACAAAAGGAGGCTGG + Intronic
911204638 1:95080009-95080031 AAGAGTAAAAAATTGGAGAGTGG + Intergenic
911209592 1:95125513-95125535 AAGACTAGTCAAGAGGAGGAGGG + Intronic
911489550 1:98546484-98546506 AAGAGTCAGCAAAAGGGGGAAGG - Intergenic
911708109 1:101038925-101038947 AAAGGTATACAATAGGAGAATGG - Intergenic
911720633 1:101187467-101187489 AAGAGTAAACAAAATGTGGAAGG + Intergenic
911757485 1:101575892-101575914 AAGAGTAAACAGCCGGAGGCAGG + Intergenic
912059874 1:105654187-105654209 AATAGTACACACTAGGGGGAAGG + Intergenic
912622550 1:111177857-111177879 AAGTGCTAACAATAGGATGAAGG - Intronic
912959044 1:114179109-114179131 AAGAGTAAACATTAGCCAGATGG - Intergenic
912981309 1:114375844-114375866 AAGAGAAAATAAGGGGAGGAAGG - Intergenic
913650188 1:120906298-120906320 AAGAGGAAACATCAGGAGTAAGG - Intergenic
913939860 1:125091637-125091659 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
913979215 1:143493455-143493477 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
914043606 1:144072789-144072811 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
914073618 1:144319105-144319127 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
914076485 1:144357208-144357230 AAGAGGAAACATCAGGAGTAAGG + Intergenic
914102693 1:144609289-144609311 AAGAGGAAACATCAGGAGTAAGG - Intergenic
914105537 1:144647255-144647277 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
914134481 1:144887702-144887724 AAAAGTAAAAAGGAGGAGGAGGG + Exonic
914170931 1:145222788-145222810 AAGAGGAAACATCAGGAGTAAGG + Intergenic
914376176 1:147075889-147075911 AAGTGTTAAAATTAGGAGGAGGG + Intergenic
914413761 1:147457871-147457893 AAAATTAAACAAAAGGAAGAAGG + Intergenic
914506929 1:148297375-148297397 AAGTGTTAAAATTAGGAGGAGGG - Intergenic
914526048 1:148466756-148466778 AAGAGGAAACATCAGGAGTAAGG + Intergenic
914640355 1:149600367-149600389 AAGAGGAAACATCAGGAGTAAGG - Intergenic
916376887 1:164164966-164164988 AAGAGAAAAAAATAAGAGAAGGG + Intergenic
918326067 1:183411907-183411929 TTGAGTAAAGAATTGGAGGAGGG + Intronic
918546210 1:185687452-185687474 GAGAGAAAAGAAAAGGAGGAAGG - Intergenic
918732093 1:188011902-188011924 AAGAGGAAACATCAGGAGTAAGG + Intergenic
919025011 1:192156792-192156814 AAGAGAAAATCATAGGAGCATGG - Intergenic
919463613 1:197907525-197907547 ATGAGAAAACAGTAGGAGAACGG - Intergenic
920286256 1:204881984-204882006 AAGAGGAAACATCAGGAGTAAGG - Intronic
920523888 1:206651177-206651199 ATGAATAAAGAAGAGGAGGATGG - Intronic
920565623 1:206970446-206970468 AAGGGGACACAAGAGGAGGAAGG - Exonic
920948946 1:210554913-210554935 AAGAGAAAACACCAGCAGGATGG - Intronic
921285043 1:213601932-213601954 AAGAGAAAAGAAAAGAAGGAAGG - Intergenic
921740438 1:218678543-218678565 ATGAGGAAATAAAAGGAGGAAGG - Intergenic
921926764 1:220717145-220717167 AAGAGAAAATAAGGGGAGGAAGG - Intergenic
922412198 1:225387778-225387800 GACAGTAAACAAAAGGAGAAAGG + Intronic
922460494 1:225811338-225811360 AAGTTTAAACAATGGGAGGTGGG - Intronic
922514905 1:226200068-226200090 AAGAGGAAATAAAAAGAGGAAGG - Intergenic
922601242 1:226856127-226856149 AAGAGAAAATAGGAGGAGGAAGG - Intergenic
923393726 1:233540296-233540318 AAGAGAAAAAAATAAAAGGAAGG + Intergenic
924160010 1:241221145-241221167 AAAAGAAAACAAAAGAAGGAAGG + Intronic
924471597 1:244347521-244347543 AAAAGTAAACAAAAGAATGAGGG + Intergenic
1063017040 10:2088676-2088698 AAGAGATAGCACTAGGAGGATGG + Intergenic
1063246475 10:4225038-4225060 AAGAGAAAATAAAAGGAAGAGGG + Intergenic
1063590143 10:7387632-7387654 AAGAGGAAACCAAAGGAGGATGG + Intronic
1064443343 10:15371993-15372015 AAGAGGAAACATCAGGGGGAAGG + Intergenic
1065348038 10:24767723-24767745 AAGAGAAAACAAAAGAAGGAAGG - Intergenic
1065667680 10:28080129-28080151 AAGAGAAAAGAAAAGAAGGAAGG + Intronic
1065758126 10:28953679-28953701 AAGAGTAATCTATAAAAGGAGGG + Intergenic
1066443572 10:35461376-35461398 AAGAGGAAACATCAGGAGTAAGG + Intronic
1066676403 10:37892012-37892034 AAGAGGAAATAAAAGGAGTAAGG + Intergenic
1066780275 10:38938148-38938170 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1066798384 10:39152993-39153015 AAGAGTAAAAACTAGAAGGAAGG + Intergenic
1066956023 10:42173434-42173456 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1069718504 10:70535525-70535547 AGGAGGAAAGAAGAGGAGGAAGG - Intronic
1070009256 10:72456302-72456324 AAGAGTGAATATTAGGAGTAGGG - Intronic
1070114227 10:73513493-73513515 AATATTCAACAATAGTAGGATGG + Intronic
1070270298 10:74947661-74947683 AAGGGTAAACTGTAGGAAGAAGG - Intronic
1070398665 10:76033956-76033978 AACAGTGAATAAAAGGAGGAAGG + Intronic
1070967127 10:80536482-80536504 AAGAGGAGACAAGGGGAGGAAGG - Intergenic
1070998763 10:80810835-80810857 AAGAGTAAGCAAGAAGAGAAGGG - Intergenic
1071720950 10:88145642-88145664 AAAAGGAAGGAATAGGAGGAAGG - Intergenic
1072348553 10:94534274-94534296 ATGAGTAAAGAAGATGAGGATGG - Exonic
1072430878 10:95369612-95369634 AAGAGCAAAGAATTGGGGGATGG - Intronic
1073025610 10:100485323-100485345 AAGAGCACACAAGAGGTGGAAGG - Intergenic
1074013124 10:109504634-109504656 AAGAGGAAATAATATGGGGATGG + Intergenic
1074133513 10:110606995-110607017 AAGAGTAAGCAATAGCCGGTCGG + Intergenic
1074168958 10:110914062-110914084 AAGAGGAAACAATAGGTGGTAGG - Intronic
1074284049 10:112081148-112081170 AAGAGAAAAGGAAAGGAGGAAGG + Intergenic
1075282456 10:121151655-121151677 CAGAGTAAACAAGGGGAGAATGG - Intergenic
1076988029 11:253405-253427 CAGAGTGAACATTAGGTGGAAGG + Intergenic
1077534685 11:3117972-3117994 AAGAGAAAATAGTAGGAGGAAGG - Intronic
1077876384 11:6311528-6311550 TTGCTTAAACAATAGGAGGAGGG + Intergenic
1078324728 11:10370228-10370250 AAGAGCAGAAAATAAGAGGACGG - Intronic
1079549769 11:21680431-21680453 AAGGGTAAAGAAGAGGAGAAAGG + Intergenic
1079684698 11:23343832-23343854 AAGAAGAAAAAATAGGAAGATGG + Intergenic
1080159778 11:29159912-29159934 AAGAGAAAAGAGGAGGAGGATGG + Intergenic
1080285982 11:30612738-30612760 AAGAGGAAACAAAAGAAAGAAGG - Intergenic
1081304130 11:41490704-41490726 AAAAATAAACAATGGGGGGAAGG + Intergenic
1083454907 11:62772012-62772034 TAGAGTAAAGATTAGGAGCAAGG + Intronic
1083524991 11:63354811-63354833 AAGGGTAAAGGATTGGAGGAAGG - Intronic
1084636677 11:70397908-70397930 AAGAGTAAACAAGGTAAGGAGGG - Intergenic
1086342859 11:85865029-85865051 TAGAGTAAACAAAAGTAGGGAGG + Intronic
1087216333 11:95499241-95499263 TTGAGGAAACAATGGGAGGAGGG - Intergenic
1087781400 11:102304660-102304682 AAGAGGATAAAAGAGGAGGAGGG + Intergenic
1087837644 11:102890897-102890919 AAGAGGCAAGAAAAGGAGGAAGG - Intergenic
1088226845 11:107629912-107629934 AAGAGGAAAGAATGGGAGCAAGG + Intronic
1088868418 11:113870879-113870901 AAAAGCAAACAAGAGGAGGAAGG + Intronic
1088883703 11:113991128-113991150 AAGAAGAAACACTAGGAGGTGGG + Intergenic
1089397203 11:118144200-118144222 AAGAGGAAACCATGGGGGGAAGG - Intronic
1089944443 11:122453746-122453768 AAGAGGAAACATAATGAGGAAGG + Intergenic
1090568435 11:128021201-128021223 AAGAAAAAACATAAGGAGGAGGG + Intergenic
1090800451 11:130168202-130168224 AAGAGCAAACAGAATGAGGAAGG + Intronic
1092055037 12:5501723-5501745 AAGAGAAGACAATAGGAGTGAGG + Intronic
1092068776 12:5615531-5615553 TTGAGTAGACAAGAGGAGGAAGG - Intronic
1092660145 12:10729923-10729945 AAGAGTAATCAATAATAGAATGG + Intergenic
1092873921 12:12831999-12832021 AGGAGTAAAGAGTAGGAGGCAGG + Intergenic
1092953569 12:13529497-13529519 AAGAGTAAACAGAAGGAAGTGGG - Intergenic
1093508370 12:19896595-19896617 AAGAAGAAAGAAGAGGAGGAAGG - Intergenic
1093577024 12:20743522-20743544 AGGAGTCAAGAAAAGGAGGAAGG - Intronic
1094107312 12:26828109-26828131 AAGAATAAACGATAGGAACAAGG + Intronic
1094801007 12:34035996-34036018 AAGAGTAGACAAAAGAAGGCAGG - Intergenic
1094863814 12:34503932-34503954 AAGATTAAAAACTAGAAGGAAGG - Intergenic
1095114147 12:38332005-38332027 AAGAGTAAACAAAAGAAGGCAGG - Intergenic
1095135430 12:38595526-38595548 AAGAGTAAACAAAAGGATTGAGG - Intergenic
1097420740 12:59375799-59375821 AAGCATCGACAATAGGAGGAGGG + Intergenic
1097547820 12:61026483-61026505 AAAAGTAAAAAAAAGAAGGAAGG - Intergenic
1098028521 12:66230831-66230853 AAGAGAAAAGGATGGGAGGAGGG - Intronic
1098193824 12:67978385-67978407 AAGAGAAAACAAAAGGAGTCAGG - Intergenic
1098911513 12:76213938-76213960 AAGAGAAGAGAAGAGGAGGAGGG - Intergenic
1099204507 12:79711896-79711918 AAGAGTAAGCAATAGCAAGGTGG - Intergenic
1099319990 12:81134168-81134190 AAGAGCAAAGAATATGAGGTCGG + Intronic
1099675833 12:85759490-85759512 AAGAGAAAAGAAAAGGAAGAGGG + Intergenic
1099788308 12:87296175-87296197 AATAGTGGACAATAGCAGGAGGG + Intergenic
1100538112 12:95530833-95530855 AACAGTCAACAATAGGGGAATGG + Intronic
1100774254 12:97956948-97956970 AACAGTGAACAATAGTGGGATGG + Intergenic
1101044931 12:100794993-100795015 AAGAGTCAACAGAAGGAGAAGGG - Exonic
1102188466 12:110967625-110967647 AAGATTAAATAAAAGGATGATGG + Intergenic
1103282581 12:119772112-119772134 AAGACCCAGCAATAGGAGGAGGG + Intronic
1105579165 13:21677319-21677341 AAGAGCAAAGAAAAGAAGGAAGG - Intronic
1106948268 13:34853344-34853366 AAGAGGAAACATTACGAGGAAGG + Intergenic
1107908159 13:45081241-45081263 AAGGGAAATCAATAGGATGAAGG - Intergenic
1109571957 13:64204579-64204601 AAGAGGAGGCAATGGGAGGAAGG - Intergenic
1110040142 13:70744633-70744655 ATGAGAAAACAATGTGAGGATGG - Intergenic
1110216475 13:73029940-73029962 AAGAGAAAAGAAGAGGAGAAGGG + Intergenic
1110228403 13:73143600-73143622 ATGGGTGAACAAGAGGAGGAAGG - Intergenic
1110444695 13:75565802-75565824 AAGAGTAAAAAATAGCAAAAAGG - Intronic
1110659419 13:78041909-78041931 AAGGGTGCAGAATAGGAGGAAGG - Intergenic
1110752788 13:79135494-79135516 AAGAGTTAACATCAGAAGGAAGG + Intergenic
1110893437 13:80718451-80718473 AAGCTTAAAAAATAGGAGCACGG + Intergenic
1111233275 13:85372761-85372783 GAGAGGAAACAAGAGGAGGAGGG - Intergenic
1111404691 13:87788107-87788129 AGGAGTAAACAATATTAGAAGGG + Intergenic
1111556344 13:89885899-89885921 AAGAATAAACAGCAGGAGAAAGG - Intergenic
1112157553 13:96834027-96834049 AAGAGAAAAAAATATCAGGAAGG + Exonic
1113106334 13:106775377-106775399 AAGAGTGAACAATGGGTGGGTGG - Intergenic
1113164261 13:107420238-107420260 AAGACAAAACAAAAAGAGGAAGG + Intronic
1114128583 14:19761190-19761212 AAAAGAAAACAAAAGAAGGAAGG - Intronic
1114725740 14:24934646-24934668 AAGACTAAACAATTGTAGGAAGG + Intronic
1115244375 14:31280189-31280211 AAGAGAAAGTAAGAGGAGGAAGG - Intergenic
1115275627 14:31605928-31605950 AAGAGAGGACAAGAGGAGGAGGG - Intronic
1116376797 14:44212528-44212550 AGGACTAAACAGTAGAAGGATGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116967041 14:51025774-51025796 TAGAGTAAAGAACAGGATGAAGG + Intronic
1117122797 14:52586581-52586603 AAGAGTAAAGAAAAGGGAGATGG - Intronic
1117399017 14:55341181-55341203 AAGAGGAAACATTTGGAGTAAGG + Intronic
1117850761 14:59966318-59966340 AAGAGCAGCCAATAAGAGGAAGG + Intronic
1118648621 14:67866154-67866176 AAGATTAAAAAATAGTTGGAAGG + Intronic
1119851048 14:77866993-77867015 ATGAGTAAATAAGAGGAGGATGG - Intronic
1120402580 14:84050670-84050692 AAGAAAAAAAAATAGTAGGAAGG + Intergenic
1120617013 14:86719390-86719412 AAGAACACACAATAGGAGAATGG - Intergenic
1120715783 14:87839435-87839457 AAGTGTAAATACTTGGAGGATGG - Intronic
1121378753 14:93441289-93441311 AAGAGTTAAAAATAAAAGGATGG - Intronic
1123392900 15:19895243-19895265 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1123571523 15:21615434-21615456 AAAAGAAAACAAAAGAAGGAGGG - Intergenic
1123608142 15:22058025-22058047 AAAAGAAAACAAAAGAAGGAGGG - Intergenic
1124081514 15:26502386-26502408 AAAAATAAACAAGAAGAGGAAGG - Intergenic
1125145243 15:36459930-36459952 AAAAGAAAACAAAAGGAGGCTGG + Intergenic
1125448629 15:39784661-39784683 ATGAGTAAAGAATATGAAGAAGG + Intergenic
1125543024 15:40482569-40482591 AAGAAGAAAACATAGGAGGAAGG - Intergenic
1125762013 15:42103258-42103280 GAGAGAAATGAATAGGAGGAAGG - Intergenic
1126177450 15:45750221-45750243 AAGATTCAACAATAGGATGTTGG - Intergenic
1126224406 15:46253625-46253647 AATAGTAAACAATGGAAGGAAGG + Intergenic
1126303811 15:47231124-47231146 AAGAGGAAAGCAGAGGAGGAAGG - Intronic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1127159550 15:56166989-56167011 GAGAGTCAACCAAAGGAGGATGG - Intronic
1127635950 15:60869822-60869844 CAGAGGGAACAAGAGGAGGATGG - Intronic
1127700392 15:61494328-61494350 ATGAGTAAAGAATAGAAGGAAGG - Intergenic
1128286794 15:66443939-66443961 AAGAGTAAAAAATAAGGGGCTGG + Intronic
1128873390 15:71181825-71181847 AAGAGTTAACAACAGGAGTCAGG - Intronic
1129141966 15:73607042-73607064 AAGAGGAAACATTAGGGGTAAGG - Intronic
1129553470 15:76479161-76479183 ATGAGGAAAAAAAAGGAGGAGGG + Intronic
1130080030 15:80724782-80724804 CAGAATGAATAATAGGAGGAGGG - Intronic
1130174364 15:81552777-81552799 AAAACTAAAGAATAGGAGCATGG - Intergenic
1130372747 15:83299975-83299997 AAGGGTGAACATCAGGAGGAAGG + Intergenic
1132027475 15:98415652-98415674 AGAAGGAAACAAGAGGAGGAGGG + Intergenic
1132447313 15:101936187-101936209 AAAAGGAAAGAAAAGGAGGAAGG + Intergenic
1202980377 15_KI270727v1_random:349823-349845 AAAAGAAAACAAAAGAAGGAGGG - Intergenic
1134072777 16:11271193-11271215 AAGAGGAAACCATGGGAAGATGG + Intronic
1136799203 16:33055254-33055276 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1136956881 16:34798203-34798225 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1138731862 16:59204480-59204502 AAGAGGACACAATTGGAGAAAGG - Intergenic
1139072893 16:63404371-63404393 TAGAATAAAGACTAGGAGGAGGG - Intergenic
1139156740 16:64452498-64452520 AAGAGTAAAAATTAGGAATAAGG + Intergenic
1140145841 16:72307702-72307724 ATGAGTAAACAATAGCCGCATGG + Intergenic
1140249064 16:73278673-73278695 AAAAGTAACCAATAGCAGGGAGG - Intergenic
1141359045 16:83377440-83377462 AAGAGGAAACCCCAGGAGGAAGG - Intronic
1141455601 16:84139642-84139664 AAGGATAAACAGTGGGAGGAAGG + Intronic
1144220721 17:13097561-13097583 AACAGAAAACAATACGAGTAAGG + Intergenic
1146055581 17:29579148-29579170 AAGAGCAAGCCAGAGGAGGAGGG - Intronic
1146733779 17:35219170-35219192 ATGAGCAAAAAATAGCAGGAGGG + Intergenic
1147116939 17:38307692-38307714 AAGAATCAACATTAGGAGGCTGG + Intronic
1148118443 17:45192425-45192447 AAGAAAAAAGAAAAGGAGGAAGG - Intergenic
1148958741 17:51375295-51375317 AAAAGTAAACTTTCGGAGGAGGG + Intergenic
1149102599 17:52924025-52924047 AAGATCAAACAAGAGGTGGAAGG - Intergenic
1149334710 17:55623793-55623815 AAAAGAAAACAATAGAAGGAAGG - Intergenic
1149910971 17:60566404-60566426 AAGGGTAAACACCAGGAGGCAGG - Intronic
1150683592 17:67302599-67302621 GAGAGTCAACACTAGAAGGAAGG + Intergenic
1153750417 18:8223886-8223908 AAGAGAGAACACTAGGAAGAAGG - Intronic
1153847807 18:9065522-9065544 AATAGAAGACAAAAGGAGGAAGG - Intergenic
1153967086 18:10191768-10191790 AAAAGTAACCAATCGCAGGAAGG - Intergenic
1155125027 18:22865836-22865858 AAGCATAAACAGTAGGAGGCAGG - Intronic
1156008279 18:32469564-32469586 CAGAATAAACAGTTGGAGGAAGG + Intronic
1157080318 18:44517777-44517799 AAGAGAAAGCAATAGCAGGAAGG + Intergenic
1157084532 18:44565750-44565772 AAGAGAAAAAAATAAAAGGAAGG + Intergenic
1158238542 18:55349546-55349568 AAGAATGAAAAAAAGGAGGAAGG + Intronic
1158437280 18:57442357-57442379 AACAGTAATTAATAAGAGGAAGG + Intronic
1158507449 18:58059228-58059250 CAGACTAGAAAATAGGAGGAGGG - Intronic
1159034297 18:63262381-63262403 AAAAGTAAAGAATCGGAGGTAGG + Intronic
1159703676 18:71660685-71660707 AAGAATAAACAATGGGAGAGAGG - Intergenic
1160637963 19:96346-96368 AAAAGGAAAGAAAAGGAGGAAGG - Intergenic
1160693637 19:472039-472061 AAAAGTTAACAATAGCAGGCCGG - Intronic
1163043098 19:14617214-14617236 AAGAGAAAAGAAAAGAAGGAAGG - Intergenic
1164511700 19:28902652-28902674 AAGAGTTAAGAATAGAAGCAGGG - Intergenic
1166282590 19:41804411-41804433 AGGCGTAAAGAAAAGGAGGAAGG + Intronic
1167191333 19:47991893-47991915 AAGATGAAAGAAGAGGAGGAAGG - Intronic
1167839848 19:52106778-52106800 AAGAGAAAATAGCAGGAGGAAGG - Intergenic
925436889 2:3846203-3846225 AAGAGGGAAGAACAGGAGGACGG - Intronic
926867279 2:17373651-17373673 GAGAGAAAAAAAGAGGAGGATGG - Intergenic
927352486 2:22133704-22133726 GAAAGGAAAGAATAGGAGGAAGG - Intergenic
930146250 2:48008015-48008037 AAGAGGAAAGGAAAGGAGGAAGG - Intergenic
930517359 2:52424718-52424740 AAAAGAAAAGAAGAGGAGGAGGG + Intergenic
931011764 2:57924505-57924527 AAAAGTGAACAATATGAGAAAGG - Intronic
931093823 2:58917298-58917320 AAGGCTAAACACCAGGAGGATGG - Intergenic
932049608 2:68385561-68385583 AAAAGGAAATAAGAGGAGGAGGG - Intronic
932123345 2:69121123-69121145 ATGAGCACACAAAAGGAGGAGGG - Intronic
932822585 2:74914220-74914242 AAAAGGAAAAAAAAGGAGGAAGG + Intergenic
933127406 2:78626511-78626533 ATGAATAAAAAATGGGAGGAAGG + Intergenic
933174394 2:79159264-79159286 CAGAGCTAACAAGAGGAGGAAGG - Intronic
933552653 2:83793999-83794021 CAGAGCAAAGAACAGGAGGATGG + Intergenic
934189312 2:89771658-89771680 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
934303943 2:91805369-91805391 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
934329311 2:92047381-92047403 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
934467530 2:94277302-94277324 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
934869877 2:97853655-97853677 AAATGTCAACAATAGGAGGCTGG + Intronic
935893603 2:107708441-107708463 AGGAATAAACAAAAGCAGGATGG + Intergenic
935921042 2:108015436-108015458 AAGAGAATACAGTAGAAGGATGG + Intergenic
936378788 2:111965841-111965863 CAGAGGAAACAAGAGGAAGAGGG - Intronic
936670525 2:114651094-114651116 AACCATAAACAATAGGAGAAAGG - Intronic
936712282 2:115144871-115144893 AAGAGTCAACACTTGGAAGAAGG - Intronic
937112904 2:119380396-119380418 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
938518670 2:132042410-132042432 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
938717528 2:134034670-134034692 AAGAGTAAAGCAGAGAAGGAAGG + Intergenic
939073783 2:137575818-137575840 AAGAGTAAACACTATTAGGAAGG - Intronic
941405769 2:165085385-165085407 AAGAGTAAACAATAGGAGGAAGG - Intergenic
941496933 2:166217092-166217114 AAGAATAAACAATGGGGGAAAGG + Intronic
942147067 2:173037444-173037466 AGGAGTAAGGACTAGGAGGAGGG - Intronic
942395961 2:175549901-175549923 AAAAGTAAACAGGAAGAGGAAGG - Intergenic
942423725 2:175837064-175837086 AAGAGTAATCAAAAGAAGAATGG + Intergenic
943183936 2:184580798-184580820 CAGAATAAAGAACAGGAGGAAGG - Intergenic
943483072 2:188446252-188446274 AAGAGTAATCATGTGGAGGATGG + Intronic
943598123 2:189881458-189881480 AAGAGAAAATAAGGGGAGGAAGG + Intronic
944019315 2:195082411-195082433 AAGAAGAAAAAAGAGGAGGAAGG - Intergenic
945509749 2:210686589-210686611 AAGAGTAAACAAGAGCAGGAGGG + Intergenic
946817633 2:223595223-223595245 CAGAGTATACAATGGGTGGAAGG + Intergenic
947414500 2:229879981-229880003 AAGACGACTCAATAGGAGGAAGG - Exonic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
948161280 2:235826909-235826931 GTTAGTGAACAATAGGAGGAAGG - Intronic
948342745 2:237268434-237268456 AAGAGGACACAGTAGGAGGCAGG - Intergenic
949035887 2:241815603-241815625 GGGAGTAAAGAATAAGAGGAAGG - Intronic
1170659284 20:18320758-18320780 AAGATTAATCAGTGGGAGGAGGG + Intergenic
1172957649 20:38772526-38772548 AAGGGGAAAAAATAGGAGGAGGG - Intergenic
1173134066 20:40423801-40423823 AAGACTGAAGAAGAGGAGGAAGG + Intergenic
1173723227 20:45278282-45278304 AAACGTTAACAATAGGATGAGGG + Intergenic
1174114463 20:48217495-48217517 AGGAGGAAACGATGGGAGGAGGG + Intergenic
1174740377 20:53007419-53007441 AAGAGTTAACAAGAGGAGTATGG + Intronic
1176743045 21:10623740-10623762 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1177589186 21:23139719-23139741 AAGAGAAAATAAGGGGAGGAAGG + Intergenic
1178742895 21:35219666-35219688 AAGAGGAAACAATAAAAGGAAGG + Intronic
1180534277 22:16383083-16383105 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1181143512 22:20825874-20825896 AAGAGTGGAGAATAGGAGGAAGG - Intronic
1181324892 22:22037107-22037129 AAGAGGGAAGAGTAGGAGGAAGG + Intergenic
1181536813 22:23550571-23550593 CAGAGGAATAAATAGGAGGATGG - Intergenic
1183013464 22:34966864-34966886 ATGAGTAAACAAAAAGGGGACGG - Intergenic
1183036918 22:35147508-35147530 AAGAGAAGACAATATGAAGATGG + Intergenic
1184041068 22:41944141-41944163 TAGAGTAAACAAAAAGAGGACGG + Intronic
1184449718 22:44575775-44575797 AAGGGGAAAGAAGAGGAGGAGGG + Intergenic
1185184011 22:49381770-49381792 AAGAGTTAACAGGAGAAGGAGGG - Intergenic
1185206108 22:49539945-49539967 ATCAGTAAACAAGAGGATGAAGG - Intronic
1203289589 22_KI270735v1_random:21714-21736 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1203315366 22_KI270737v1_random:2713-2735 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
949305930 3:2640976-2640998 AAGAGAAAAAAATTGGAGGGAGG + Intronic
949389934 3:3549531-3549553 AATAGTAATCAAAAGGAGCAGGG - Intergenic
951119014 3:18901545-18901567 AGGAGTGAACATCAGGAGGAGGG + Intergenic
952141996 3:30490138-30490160 TATAGTAAACAACAGGAGAATGG + Intergenic
952574302 3:34756131-34756153 AAGAATGAACATTAGGAGAATGG - Intergenic
952581577 3:34839435-34839457 CAGAGTAAAGAATATAAGGAAGG + Intergenic
953784796 3:45903311-45903333 AAGAGTAAGCAATAGGGATAAGG + Intronic
954064158 3:48092574-48092596 CAGAGGAAACAATATGAGGAGGG - Intergenic
955976474 3:64485113-64485135 AAGAATAGACAACAGGGGGAAGG - Intergenic
956024530 3:64969051-64969073 AAAAGTAAATAACATGAGGAAGG - Intergenic
956219229 3:66884361-66884383 AGGAGGAAACAAAAGAAGGAAGG + Intergenic
956858668 3:73301163-73301185 AGGAGAAAAGAAAAGGAGGAAGG - Intergenic
957167991 3:76699803-76699825 AAGAGGAAACAGGGGGAGGAAGG - Intronic
957613722 3:82502437-82502459 AGGAGAAAACAAAAGCAGGAAGG + Intergenic
957640776 3:82850374-82850396 AAGAGAAAAGAAGAGGAAGAAGG - Intergenic
958439866 3:94143139-94143161 AAGAGGATATAATAGGAGGGTGG + Intergenic
958503114 3:94939586-94939608 AAGAGTAAAGGAAAGGAAGAAGG + Intergenic
958953629 3:100442938-100442960 AAGAGAAAATAGGAGGAGGAAGG + Intronic
959255232 3:104002312-104002334 AAGAGCAAACATTAGGGGTAAGG + Intergenic
962047732 3:131778290-131778312 AAGGGTACACGATAGGAGGAGGG - Intronic
963125852 3:141815501-141815523 AAGAGTAACCAAGAGGAGTATGG + Intronic
965332890 3:167399401-167399423 AAGAGTAGACAATAGTAGAAGGG - Intergenic
965425933 3:168522812-168522834 AAGATTCTATAATAGGAGGAAGG - Intergenic
965756211 3:172029912-172029934 AAGAGGAAGCAAGAGAAGGAAGG - Intergenic
965935745 3:174108661-174108683 AAGAGGAAACATCAGGAGTAAGG + Intronic
966374936 3:179286804-179286826 AAGAGGAAACAAAGGTAGGAGGG - Intergenic
967079913 3:186040236-186040258 GAGAGTAAAGAATGGGTGGAGGG + Intergenic
967202796 3:187088350-187088372 AAAAGTAGAAAATAGAAGGATGG - Intergenic
968139685 3:196245700-196245722 CAAAGTAAAGAATAGGAGGCCGG + Intronic
968325775 3:197813979-197814001 CTGAGTAAACAATAGATGGATGG - Intronic
969727780 4:8934091-8934113 AAGAGAAAATAGGAGGAGGAAGG - Intergenic
969920801 4:10537780-10537802 AAGAACAAACAAGAGAAGGAAGG - Intronic
970450989 4:16166263-16166285 CAGAGAAAACAAAAGCAGGACGG - Intronic
970938699 4:21605979-21606001 AAGAGAAAACAACAGAAGGAAGG - Intronic
971059001 4:22945884-22945906 AAGAGTATACAATAGGATTTGGG + Intergenic
971644797 4:29185161-29185183 ATGAGCAAAGAATAGAAGGAGGG - Intergenic
972732562 4:41809213-41809235 AAGGGGAAACAGTAGTAGGAAGG - Intergenic
973245318 4:48004633-48004655 AAGAGAAAATAGGAGGAGGAAGG + Intronic
974012899 4:56623711-56623733 AAGAGAAAAAATGAGGAGGAAGG - Intergenic
974167879 4:58227448-58227470 GAGAGTAAATAATATCAGGAAGG + Intergenic
975256332 4:72240057-72240079 AAGATTAAACAAAAGGAAGGAGG + Intergenic
975412048 4:74064761-74064783 ACAAATAAAAAATAGGAGGAGGG - Intergenic
975789167 4:77930014-77930036 AAAAGTAAATAATAGCAGGTTGG + Intronic
975854348 4:78607382-78607404 ATGTCTAAACAATAGGTGGAAGG - Intronic
976267596 4:83198939-83198961 AAGAATAAAGAACAGTAGGAGGG + Intergenic
976856232 4:89608705-89608727 AAGAGTAAATGATGGGAGTAGGG + Intergenic
976980125 4:91217173-91217195 AAGAGTAAGCAGTAGCAAGAGGG + Intronic
977004463 4:91547530-91547552 AAAAGTAAACAGAAGGAAGAAGG - Intronic
977349754 4:95867518-95867540 AAGAGGCAGCACTAGGAGGATGG - Intergenic
977359399 4:95983657-95983679 AAGAGGAAACAGTGGCAGGAAGG + Intergenic
977710121 4:100115071-100115093 AAGAGGAAGCATTAGGAGTAAGG - Intergenic
978176033 4:105733511-105733533 AACAGAAAACAATAGAAGGCAGG - Intronic
978667588 4:111204146-111204168 AAGAGAAAGAAATAGAAGGAAGG + Intergenic
979415298 4:120430535-120430557 CTGAGTAAACCATAGGAGTAAGG - Intergenic
980396226 4:132219105-132219127 AAGAGCAAACAATAGAAGCAGGG - Intergenic
980581468 4:134759490-134759512 AAGAGTAAAAACTAAGAGGTAGG + Intergenic
980581769 4:134763471-134763493 AAGAGCAAAAAGTGGGAGGAAGG - Intergenic
980735108 4:136875270-136875292 AAGAGTATACAATAGGAGAAGGG - Intergenic
981898072 4:149828263-149828285 AAGAGTAAACAGAAGGCAGATGG - Intergenic
982475873 4:155849945-155849967 AAGAGAAAATAGTGGGAGGAAGG - Intronic
983104080 4:163663633-163663655 AAGAGTGAGCAATAGGTGGCAGG + Intronic
983222622 4:165056991-165057013 CAGAGTGAAAAATAGGTGGAAGG + Intergenic
983568603 4:169180550-169180572 CAGAGTAAACAAGGGGAGTATGG + Intronic
983658713 4:170110101-170110123 AATAGGAAAGAGTAGGAGGAAGG + Intergenic
983914199 4:173273770-173273792 AAAAGTTAAAAATAGAAGGAGGG - Intronic
984094027 4:175411846-175411868 AAAAAAAAACAATATGAGGAGGG - Intergenic
984337344 4:178409534-178409556 AGGAGTAAATAATAGAAGTAAGG - Intergenic
985192346 4:187389571-187389593 AAGAGTAACCAGCAGAAGGAGGG + Intergenic
985231946 4:187827890-187827912 AAGAGGAAACATTAGTAGTAAGG - Intergenic
985294827 4:188425512-188425534 AAGAGAAAGCAAGAGCAGGATGG - Intergenic
986839126 5:11675531-11675553 AAGAGTTAAAAATTGGAGGGGGG - Intronic
986919895 5:12667810-12667832 CAGAGCAAAGAACAGGAGGACGG + Intergenic
987904973 5:24064615-24064637 AAGAGTTAACATTAGGACTATGG + Intronic
988185746 5:27859359-27859381 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
988361723 5:30244421-30244443 AAAAGTAAAGAATAGTAAGATGG - Intergenic
988836072 5:35033559-35033581 GAGAAGAAACAACAGGAGGATGG + Intronic
988980568 5:36564060-36564082 AAGAGTAATGAAGAGGTGGATGG + Intergenic
989202971 5:38784057-38784079 AAGAGAAAACAATTTGAGGAAGG + Intergenic
989316960 5:40092565-40092587 AAGAGAAAATAGTGGGAGGAAGG - Intergenic
989458275 5:41667207-41667229 TAGAGGAAACAAGAGGAAGAAGG + Intergenic
989755623 5:44949586-44949608 AAGAGTAGATAATAGTAGGTAGG - Intergenic
989852412 5:46230707-46230729 CAGAGTAAAAAACTGGAGGACGG + Intergenic
989981287 5:50648833-50648855 AAGAGGAAACATCAGGAGTAAGG - Intergenic
990377849 5:55190608-55190630 GAGAGTAACAAATACGAGGAGGG + Intergenic
990429559 5:55720998-55721020 AAGAGTAAGCAAAAGCAGGAGGG + Intronic
990504419 5:56430520-56430542 AAGAGTTATGAATAGCAGGATGG - Intergenic
991983428 5:72257786-72257808 AAGATTAAAGAATTGGAGGCTGG + Intronic
993063103 5:83064772-83064794 AAGAGTAAAAAATCGCATGAGGG - Intronic
993393199 5:87347372-87347394 AAGAATAAACAATGACAGGATGG - Intronic
994174678 5:96698522-96698544 AAAAGTAAAAAATATGAGAACGG - Intronic
994286709 5:97977845-97977867 AAGAGAAAACAATGGGAAGATGG - Intergenic
995117955 5:108502639-108502661 AACAGAAAGCAATAGAAGGAAGG - Intergenic
995456207 5:112354978-112355000 CAAAATAAACAAAAGGAGGAAGG + Intronic
995818917 5:116204423-116204445 AAAAGAAAAAAAAAGGAGGATGG - Intronic
996150654 5:120030374-120030396 ATGAGTAAGCAATAGAATGATGG - Intergenic
996315677 5:122158219-122158241 AAGAGGAAACATGTGGAGGAAGG + Intronic
996808491 5:127486183-127486205 AACAGTAAAAAAAAGGGGGAGGG - Intergenic
996985149 5:129552992-129553014 GAGAGTCAACAGTAGGAAGATGG - Intronic
997576430 5:134981090-134981112 AAGAAGAAACAAAAGAAGGAAGG - Intronic
997790453 5:136754921-136754943 AAGAGTGAAGGTTAGGAGGAAGG - Intergenic
998578237 5:143341183-143341205 AAGAATGAACAATAGGATAATGG + Intronic
998894505 5:146785188-146785210 AAGAGTATAGAAAAGGAGGAAGG + Intronic
999644028 5:153700436-153700458 AAGTATAAACAATAGGATGGTGG + Intronic
999796129 5:154991358-154991380 AAGTGTAAACTCTAGGAAGAGGG + Intergenic
1000299242 5:159940445-159940467 AAGAGAAAACATCAGGAGTAAGG - Intronic
1000731399 5:164838651-164838673 AATAGGAAAGAAAAGGAGGAAGG - Intergenic
1001266432 5:170277840-170277862 AAGAGGAAAGAGAAGGAGGAAGG + Intronic
1001768007 5:174269600-174269622 AAGACTACACAATAGGGGAAGGG + Intergenic
1002254782 5:177951026-177951048 AAAGGTAAACAATAAGGGGATGG - Intergenic
1004504939 6:16239641-16239663 AGGAGTAAACACGAGGAGGCTGG + Intronic
1005162704 6:22883210-22883232 AGAGGTAAAGAATAGGAGGAAGG - Intergenic
1006687797 6:35851880-35851902 AAAAGTAAACAATAAGGGCAAGG + Intronic
1007003597 6:38337888-38337910 AAGACTGAAATATAGGAGGAAGG + Intronic
1007779421 6:44244234-44244256 AAGTGTGAACCATAGGAGGATGG - Intergenic
1007941982 6:45789898-45789920 AAGAGGAGAGAACAGGAGGAAGG + Intergenic
1007961748 6:45966644-45966666 AAAAGGAAACAAAAAGAGGAGGG - Intronic
1008027538 6:46654841-46654863 AAGAGAAAACAATGTGGGGAAGG - Intronic
1008167721 6:48160064-48160086 AAGAGAAAAAAATAGGATGCAGG - Intergenic
1008651012 6:53562796-53562818 AAGAGACAATAGTAGGAGGAAGG - Intronic
1008752115 6:54747504-54747526 AAGAGAAAAAAAAAGGATGAAGG - Intergenic
1009362624 6:62834378-62834400 GAGGGTAAAGAATAGGAGGAAGG - Intergenic
1010738279 6:79468094-79468116 AATAATAAATTATAGGAGGAGGG - Intergenic
1011038971 6:83009960-83009982 GAGAGTAGACAAATGGAGGAGGG + Intronic
1011199052 6:84814643-84814665 AAGTGTAAAAAAAAGGAGGGGGG - Intergenic
1011722641 6:90174979-90175001 AGGAGAAAACAATAGGAGAGAGG + Intronic
1012112398 6:95253298-95253320 AATGGTAAACAATCGGTGGATGG - Intergenic
1012338907 6:98093952-98093974 AAGACTACACAATAGGAGTGTGG + Intergenic
1012412150 6:98970766-98970788 AAGAGAAAATAATAGATGGAGGG - Intergenic
1013098287 6:106966155-106966177 AAGAGTAAATTATATGAGGAAGG + Intergenic
1013689759 6:112627552-112627574 AAGAATAAAGAATGGGAGGCTGG - Intergenic
1014536234 6:122616280-122616302 AAGAGGACATAATAGGAGAAGGG + Intronic
1014758805 6:125331841-125331863 AAGAAGAAAGAAAAGGAGGAGGG - Intergenic
1014830514 6:126097901-126097923 AAGAATAAACAAAAAGAGTATGG - Intergenic
1014916863 6:127161120-127161142 CAGAGGAAACAATAAGAGGTGGG - Intronic
1015435458 6:133181524-133181546 AATATTAAACAATATGGGGATGG + Intergenic
1015607519 6:134973991-134974013 AAGAGGAAATAATAGAAGAATGG - Intronic
1015678057 6:135772474-135772496 AAGAGTAAACATAAGGAAGGTGG - Intergenic
1015871383 6:137779837-137779859 AAGAGGAAACATCAGGAAGAAGG - Intergenic
1016380781 6:143476473-143476495 AAGAGATAAGAATAGAAGGAGGG + Intronic
1017604789 6:156122439-156122461 AAGGATAAACTATAGGATGATGG - Intergenic
1019060874 6:169256558-169256580 AAGAATAAAGAATATGAAGACGG + Intergenic
1019211526 6:170409364-170409386 AAAAGTAAATAATAAAAGGAAGG + Intergenic
1019903654 7:4043975-4043997 AAGAAAACACAAGAGGAGGAAGG - Intronic
1020646117 7:10816254-10816276 TAGAGTAACTAAAAGGAGGATGG + Intergenic
1022353373 7:29587006-29587028 AAGATTTTACAATAGGAGGCTGG - Intergenic
1022368559 7:29749418-29749440 AAGAAAAAAAAACAGGAGGAAGG - Intergenic
1023215604 7:37859307-37859329 AAGAATAAGCATTAGAAGGATGG - Intronic
1024663603 7:51522798-51522820 CAGAGAAAACAAAAAGAGGATGG - Intergenic
1024859893 7:53826275-53826297 AAGAGAAAAGAAAAGAAGGAGGG + Intergenic
1024955093 7:54910281-54910303 AAGAGTAAACACATTGAGGAAGG + Intergenic
1025307290 7:57873029-57873051 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1026032024 7:66802509-66802531 AAGAGTAAATCATAGCAGGCAGG + Intronic
1027550223 7:79583716-79583738 AAGACTACACAATGGGAGAATGG - Intergenic
1027671564 7:81105719-81105741 AAGAGGAAACATTATGAGTAAGG + Intergenic
1027960256 7:84937223-84937245 AAGAAGAAGCAATAGGAAGAAGG + Intergenic
1028074503 7:86494879-86494901 AAGATAAAACAATAGAAGAAAGG - Intergenic
1028510847 7:91624776-91624798 AAGAGAAGACAATATGAGCAGGG - Intergenic
1029901794 7:104048819-104048841 AAGAGAAAAGAAGGGGAGGAAGG - Intergenic
1031070185 7:117153442-117153464 TAGAGTAAAAAAGAAGAGGAGGG + Intronic
1031297560 7:120022062-120022084 AATAATTAAAAATAGGAGGAAGG - Intergenic
1031995269 7:128226491-128226513 AAGGATGGACAATAGGAGGATGG - Intergenic
1031995274 7:128226514-128226536 AAGGATGGACAATAGGAGGATGG - Intergenic
1033075733 7:138248693-138248715 AAGAGAAAAAAAGAAGAGGAGGG + Intergenic
1034087824 7:148336346-148336368 AATAGTTAAAAAAAGGAGGAAGG + Intronic
1036930620 8:12952014-12952036 AAGAGGAAAAAATAGACGGAGGG - Intronic
1038186206 8:25277427-25277449 AACAGTAAAAAAAAAGAGGAAGG + Intronic
1038530800 8:28316868-28316890 AGGAGTGAAGAATAGGAGGCAGG - Intergenic
1038831051 8:31061049-31061071 AAGAGAAAAGAATAACAGGATGG - Intronic
1039239476 8:35539961-35539983 AAGAGTGAAAAATATGAGAATGG + Intronic
1039262585 8:35787987-35788009 AAGAAAAAAGAAAAGGAGGAAGG + Intronic
1040813859 8:51485610-51485632 CAGAGGAAACATTAGGAGAAAGG - Intronic
1041131424 8:54706261-54706283 AAAAGTAAACAAAAGGAGGTTGG - Intergenic
1042422343 8:68606655-68606677 AATAGTAAAGATTAGGAGGCAGG - Intronic
1042734591 8:71974193-71974215 AAAAGTAAAGAAAAGGGGGAGGG + Intronic
1043310889 8:78858466-78858488 AAAAGTAAACAATAAAAGGATGG + Intergenic
1043425795 8:80147477-80147499 AACAGTCAACACTAGTAGGAAGG + Intronic
1043727869 8:83633957-83633979 AAGAAAAAAAAAGAGGAGGAAGG - Intergenic
1044112541 8:88293247-88293269 AAGAGGAAACAGTGGAAGGAGGG - Intronic
1044220659 8:89665293-89665315 AAGAGAAAACATGAGGGGGAAGG - Intergenic
1044998113 8:97856244-97856266 TAGAGTAAAAAATAGGAAGGGGG - Intergenic
1045804467 8:106141356-106141378 AAGAATAAACAAGAGCAAGAGGG - Intergenic
1046476362 8:114749868-114749890 AAGAAAAAAAAATAGGAGGAGGG - Intergenic
1046988231 8:120415698-120415720 AAGTGATAACAATAGGAGAAAGG - Intronic
1047318013 8:123752518-123752540 GAGAGTAAACAATATGAGACAGG - Intergenic
1047354887 8:124111179-124111201 AAGAGAAAAGAAAAGGGGGAAGG + Intronic
1047832968 8:128656382-128656404 AAGAGGTAAGAATAAGAGGATGG + Intergenic
1048142896 8:131812096-131812118 AAGAATATAAAATAGGAGGGGGG + Intergenic
1048159270 8:131997806-131997828 AATAGTTAACAAAAGGAGAAAGG - Intronic
1048388182 8:133933293-133933315 AAGAGTAAACATCAGGATAAAGG + Intergenic
1050849561 9:10266396-10266418 AAGAGAAAGCAATAAGAGAATGG + Intronic
1051329658 9:16010860-16010882 AAGAGTATACAATGAGAAGAGGG + Intronic
1051884207 9:21873028-21873050 AAGAGGAGAGAATAGGAAGAGGG - Intronic
1051938205 9:22470388-22470410 ATGAGTAAACAATCTGAGAAAGG + Intergenic
1052247702 9:26357437-26357459 AAGAGTAAACAATATTAACAAGG - Intergenic
1052281936 9:26742855-26742877 AAGAATAAAGAATGGGAGGAAGG + Intergenic
1052644682 9:31218264-31218286 CACATTAAACAATGGGAGGATGG - Intergenic
1053039795 9:34860560-34860582 GAGAGAAAAAAATAGAAGGAAGG - Intergenic
1053541014 9:38973813-38973835 CTGAGTAAACAATGTGAGGATGG - Intergenic
1053805435 9:41796861-41796883 CTGAGTAAACAATGTGAGGATGG - Intergenic
1053943951 9:43285582-43285604 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1054625126 9:67390094-67390116 CTGAGTAAACAATGTGAGGATGG + Intergenic
1055009143 9:71544590-71544612 GAGAGTAAAGAATGGGAGGAAGG + Intergenic
1055542433 9:77325548-77325570 AAGAGAAAACAAAGGGAAGATGG - Intronic
1055826689 9:80335003-80335025 AGAAGAAAAAAATAGGAGGACGG + Intergenic
1058825995 9:108776387-108776409 AAAAGAAAAAAATGGGAGGAAGG + Intergenic
1059066361 9:111089738-111089760 AACAGTAAACATTAGAAGGCTGG + Intergenic
1059181731 9:112220985-112221007 AAGATTAAAAAATATCAGGATGG - Exonic
1060030941 9:120214274-120214296 AAGAGAAAAGAAGAGAAGGAGGG + Intergenic
1060269203 9:122129030-122129052 CTTAGTAAACAATAGGATGAAGG + Intergenic
1060378613 9:123142585-123142607 AAGAGGAAACATCAGGATGAAGG - Intronic
1060476377 9:123989861-123989883 AAGAGGAAAAAAAAGAAGGAAGG + Intergenic
1060578751 9:124724025-124724047 AATGCTCAACAATAGGAGGATGG + Intronic
1060859928 9:126946008-126946030 AAGAATAAACCATAGAGGGACGG + Intronic
1061245001 9:129397087-129397109 CAGAGGAATAAATAGGAGGATGG + Intergenic
1062082949 9:134634058-134634080 AAAAGGATACAAGAGGAGGAGGG - Intergenic
1203587086 Un_KI270747v1:14159-14181 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1185686720 X:1934884-1934906 AAAAGAAAAGAAAAGGAGGAGGG + Intergenic
1186755794 X:12670208-12670230 AACAGTAAACAAGAGAATGAGGG - Intronic
1187802009 X:23074425-23074447 GAGGGTAAACAGTGGGAGGAGGG + Intergenic
1187827484 X:23346426-23346448 AAGAGGAAACATCAGGGGGAAGG + Intronic
1187993747 X:24903865-24903887 AAAAGTAAACAGTAGCAGGTAGG + Intronic
1188386116 X:29561081-29561103 AAGAGGAAACAAGAGGAGTGGGG - Intronic
1188472261 X:30553942-30553964 AAGAGGAAAAAAGAAGAGGAAGG + Intergenic
1188666452 X:32827575-32827597 AAGAGTAAAAGGTGGGAGGAGGG - Intronic
1188959727 X:36476195-36476217 GAGGGTAGACAATAGGAAGAAGG + Intergenic
1189961192 X:46326420-46326442 AAGAGAAAACACTAGGAGGATGG - Intergenic
1191676279 X:63795327-63795349 AGGAGAAAAGAAGAGGAGGAGGG + Intergenic
1192092890 X:68179645-68179667 AAGAGGAAACATCAGGAGTAAGG - Intronic
1192131474 X:68555602-68555624 AAAAGTAAACAGTAGCAGGAGGG - Intergenic
1192270220 X:69572160-69572182 AAGAGTAAATAAGAGGTAGAAGG - Intergenic
1192866432 X:75137871-75137893 GAGGGTAGACAATGGGAGGAGGG + Intronic
1193292530 X:79792376-79792398 AAGAGGAAAAAGTGGGAGGATGG - Intergenic
1194044843 X:88989787-88989809 AAGAGCAAATAGTGGGAGGAAGG - Intergenic
1195478297 X:105313575-105313597 AAGAATAAACAAATGGAGGGGGG - Intronic
1195548199 X:106137481-106137503 AAAAGTAAAAAATAGGAGCTGGG + Intergenic
1195897327 X:109759845-109759867 AAGAAGAAACAATATGAGCAAGG + Intergenic
1196267982 X:113675316-113675338 AGGAGTCAACAATAGGAGAGTGG + Intergenic
1197727481 X:129785997-129786019 AAGAGGAAAGAATAGTGGGAGGG + Intronic
1197922209 X:131607366-131607388 AAGAATCAACAGTAGGAGCAGGG - Intergenic
1198156779 X:133968401-133968423 AAGAGTAATCATTAGGAACATGG + Intronic
1198412538 X:136386117-136386139 AAGAGTAAACACTTGGAAAAAGG - Intronic
1198682644 X:139199309-139199331 AAGATTAAGCAATTGAAGGAGGG - Intronic
1198952374 X:142086385-142086407 AAGAGAAAATAAGGGGAGGAAGG - Intergenic
1199014382 X:142796080-142796102 AAGATTAAACAATTTGATGAAGG + Intergenic
1199321172 X:146440990-146441012 AAGAGAAAACAGGGGGAGGAAGG + Intergenic
1201195071 Y:11485296-11485318 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1201254391 Y:12092614-12092636 AAGAGAAAAGAAAAGAAGGAAGG + Intergenic