ID: 941405965

View in Genome Browser
Species Human (GRCh38)
Location 2:165089005-165089027
Sequence TAACCAAGACTTGTGAAGAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941405964_941405965 -5 Left 941405964 2:165088987-165089009 CCAATATGTGACATTCTTTAACC 0: 1
1: 0
2: 1
3: 8
4: 203
Right 941405965 2:165089005-165089027 TAACCAAGACTTGTGAAGAATGG 0: 1
1: 0
2: 1
3: 18
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941405965 Original CRISPR TAACCAAGACTTGTGAAGAA TGG Exonic
904168048 1:28571340-28571362 TAACCATGACTTGGCAAGACTGG + Intronic
906371870 1:45260866-45260888 TAAACAAAAGTTGTGAAGATAGG - Intronic
906858139 1:49330377-49330399 TCACCCAGACTTGTGCAGAGTGG - Intronic
907710317 1:56874877-56874899 CAACCAAGACTTGTGCAGCCTGG - Intronic
908916889 1:69138451-69138473 GCACCAAGACTTGTGTAGAATGG + Intergenic
909273032 1:73648764-73648786 TAAACAAGAATTTGGAAGAAAGG - Intergenic
909758041 1:79252145-79252167 TAACAAATAATGGTGAAGAAGGG - Intergenic
910674161 1:89800362-89800384 TGACCAAGAGTTGGGAAGACAGG + Intronic
911562644 1:99425279-99425301 TAACCAAGACTTCTTGAAAATGG + Intergenic
913526626 1:119699888-119699910 TAATCAAGACTTGTGGAAGAAGG - Intronic
914593108 1:149123886-149123908 TAACGAAGAGTTCTGAACAAAGG - Intergenic
914925962 1:151887853-151887875 TAACCAAAACAAGTGAAGAAAGG - Intronic
916690075 1:167181509-167181531 TAACCGAGACATATGAAGCAGGG - Intergenic
919331273 1:196175281-196175303 TACACTAGACTTCTGAAGAAAGG + Intergenic
922199148 1:223386883-223386905 TAACCAATTCTTATGAAGAAAGG - Intergenic
922371555 1:224916345-224916367 AAACCAAGACTTGGAAAAAATGG + Intronic
922740201 1:228010249-228010271 TAACCCAGACATGGGAAGAAGGG - Intronic
1062799608 10:369344-369366 TAACAAAGACTTCAGAAGACTGG + Intronic
1063179777 10:3587684-3587706 TTCCCAAGACTTGCAAAGAAGGG - Intergenic
1064476631 10:15697329-15697351 GAATCAATAATTGTGAAGAATGG + Intronic
1068566059 10:58576931-58576953 TAACGAAGACTTGTGGATGAGGG + Intronic
1071215520 10:83396193-83396215 TAACCTAAACTTGTGAGGTAGGG - Intergenic
1071746297 10:88423219-88423241 TGACCCTGACTTGTAAAGAATGG + Intronic
1071872287 10:89808730-89808752 TAAATAAGGCTTATGAAGAAAGG - Intergenic
1074658599 10:115623457-115623479 TTACCAAAACTTCTGAAGTATGG + Intronic
1075400382 10:122157125-122157147 TAAAATAGACTTGTGAAGACAGG + Intronic
1079965343 11:26973118-26973140 TAACAAAGACTTTCAAAGAAAGG + Intergenic
1088129002 11:106464805-106464827 TAACAATGACTTGTCAAAAAAGG + Intergenic
1088200436 11:107327004-107327026 GAACCAAGACTTTGGAGGAAAGG - Exonic
1088390615 11:109310627-109310649 TAACAAGGATTTCTGAAGAAGGG - Intergenic
1088605771 11:111529739-111529761 GAACCAGGTCTTGAGAAGAAAGG + Intronic
1089126061 11:116177502-116177524 TTACCAAGAATTGAGAAGGAAGG + Intergenic
1089846349 11:121461501-121461523 TAAACAAGACTAATGGAGAAGGG - Intronic
1090433801 11:126669043-126669065 TTACCAAGAATTGTCAAAAAGGG - Intronic
1092493664 12:8970074-8970096 TAGCCCAGACTGGTGGAGAATGG - Intronic
1092851419 12:12631601-12631623 AAACTATGAATTGTGAAGAATGG + Intronic
1093484598 12:19639666-19639688 TAACTATTATTTGTGAAGAAGGG - Intronic
1093539012 12:20258312-20258334 TATCCAAGACTGCTTAAGAAAGG - Intergenic
1097676892 12:62612692-62612714 TGACCATGACTTTTGGAGAAGGG - Intergenic
1097906724 12:64927569-64927591 TTAGCAAGACTAGTCAAGAAAGG - Intergenic
1103252566 12:119512982-119513004 TGAACAAGAATTGGGAAGAAGGG - Intronic
1106373928 13:29165252-29165274 TAGCCGAGATCTGTGAAGAATGG - Intronic
1107524759 13:41219577-41219599 GAACCATGAATTTTGAAGAAAGG + Intronic
1107890387 13:44909358-44909380 TGACCAAGACTTGTGAAAAATGG + Intergenic
1108411264 13:50149780-50149802 AAAATAAGACTTATGAAGAAAGG + Intronic
1109285479 13:60404068-60404090 TAACCCAGACTTGGGAAGGTTGG + Intronic
1109530007 13:63630710-63630732 TCAGCAGGCCTTGTGAAGAAAGG - Intergenic
1110134316 13:72046489-72046511 TAACAAAACCTTGTGAAGGAAGG - Intergenic
1110974895 13:81818774-81818796 TAACCATTACTTTTGAAGCATGG - Intergenic
1112018972 13:95355051-95355073 TAAGGAAGCATTGTGAAGAATGG + Intergenic
1114576799 14:23722229-23722251 TAACCAAAATTTTTGAGGAATGG - Intergenic
1116713629 14:48400111-48400133 TAACCAAGATTTGTGGAGTTTGG - Intergenic
1118484106 14:66197536-66197558 TAACCAAGAGTTGTGAGAGAGGG - Intergenic
1120296265 14:82646064-82646086 TAAAATAGACTTTTGAAGAAGGG - Intergenic
1120373108 14:83664517-83664539 AAAACAAGACATGTGAAAAAAGG + Intergenic
1120473754 14:84960518-84960540 TAACCACGCCTTGTAAATAATGG + Intergenic
1120568805 14:86092473-86092495 TAAACAAGATGAGTGAAGAAAGG + Intergenic
1120787208 14:88548784-88548806 TATGCAAGGCCTGTGAAGAAAGG - Intronic
1124155634 15:27222985-27223007 TCAACAAAACTTGTGAACAAAGG - Intronic
1124390102 15:29247339-29247361 TTGCCAAGACTTGGAAAGAATGG - Intronic
1124485289 15:30109126-30109148 TATCCAAAACTAGTGAGGAAGGG - Intergenic
1124518289 15:30388146-30388168 TATCCAAAACTAGTGAGGAAGGG + Intronic
1124540364 15:30578103-30578125 TATCCAAAACTAGTGAGGAAGGG - Intergenic
1124758289 15:32429477-32429499 TATCCAAAACTAGTGAGGAAGGG + Intergenic
1126782247 15:52148856-52148878 TAGCCATTACTTGTGAGGAAAGG - Intronic
1130870391 15:87966838-87966860 TACCCAAGACTAGTGAATACTGG + Intronic
1135245737 16:20855434-20855456 TATCCAAGATTTGTGTTGAAAGG + Exonic
1138262869 16:55637960-55637982 TAAGCCAGACTTCTGAAAAACGG + Intergenic
1139171952 16:64641246-64641268 TAACTAAGACCTGTCAAGATGGG - Intergenic
1140936180 16:79672353-79672375 TCAGCAAGACTTGTGAATATTGG - Intergenic
1141645881 16:85367339-85367361 CAATCAACACTTGTGAACAAAGG - Intergenic
1143877980 17:10007314-10007336 TAACCAAGACGTCTAAAGAATGG + Intronic
1144289038 17:13807706-13807728 ATACCAAGCCTTGAGAAGAAGGG + Intergenic
1149395095 17:56232180-56232202 AAACCAAGTCGTGTGAAGAATGG - Intronic
1149856999 17:60091484-60091506 TAATTAAGACTTCTAAAGAATGG + Intergenic
1152421869 17:80197997-80198019 TGACCAAGATCTGTGAAGAAGGG + Intronic
1154315406 18:13300104-13300126 GAACCAAGATGTGTGAAGCATGG - Intronic
1156763525 18:40623035-40623057 TAAGCAAAACTTGTGTAGAGAGG - Intergenic
1158447198 18:57531836-57531858 TAACCTGGTCTTGTGAAGAAAGG + Intergenic
1159443582 18:68511990-68512012 TAACTATGACATGTAAAGAAAGG - Intergenic
1166205629 19:41266879-41266901 TTGCAGAGACTTGTGAAGAAAGG + Intronic
1168336765 19:55601442-55601464 TAATCAAGACTTTTGCAAAATGG - Intronic
1168531035 19:57129132-57129154 TCACCAACACATGTGAAAAAGGG + Exonic
925496158 2:4452018-4452040 TAAGCAACACTTTTGAAAAAAGG + Intergenic
926270282 2:11360630-11360652 GAACAAAGACCTGAGAAGAAGGG - Intergenic
926326634 2:11790020-11790042 TTTCCAAAACTTGTGAAGATAGG + Intronic
926476196 2:13326002-13326024 TAAACAATACTTATGAGGAAGGG - Intergenic
927050357 2:19321873-19321895 TAACCCAGTCTTCTGAAGATTGG + Intergenic
933319184 2:80751297-80751319 TAAACAAGAGTGGTGAAAAAAGG + Intergenic
933979687 2:87539635-87539657 TTCCCAAGGCTTGTGAAGCAGGG - Intergenic
936927114 2:117748744-117748766 TATCCAAGACTAGTTATGAAAGG + Intergenic
938672945 2:133602795-133602817 TAACCCAGTCTTGCGAAGGACGG + Intergenic
938713594 2:133998091-133998113 TAAGCAAGTCTTTTGAACAAGGG - Intergenic
940840474 2:158574355-158574377 TAAACAAAAAATGTGAAGAATGG - Intronic
941091636 2:161183170-161183192 TAACAATGATTTCTGAAGAATGG - Intronic
941405965 2:165089005-165089027 TAACCAAGACTTGTGAAGAATGG + Exonic
945362697 2:208910810-208910832 TCACCAAAACTCGTGTAGAAGGG + Intergenic
948326666 2:237127350-237127372 TAACCAATACTTTTGAACAATGG - Intergenic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1172950483 20:38720249-38720271 CCACCAAGCCTTGTGAAGCAAGG - Intergenic
1175005694 20:55679792-55679814 TAAGCAAGACAGGTAAAGAAGGG + Intergenic
1175484315 20:59334407-59334429 TAACCAAGACAATTGAAGGATGG + Intergenic
1177784645 21:25658077-25658099 TAGACTAGACTTGGGAAGAAAGG + Intronic
1181590382 22:23881028-23881050 TAACAAAGACCTGTGAAATATGG - Intronic
950979004 3:17281179-17281201 CAACCAAGACTTCTGAAAGATGG + Intronic
951408594 3:22332554-22332576 AAAACAAGAGTTGAGAAGAATGG + Intronic
952224655 3:31362966-31362988 TAACCCACACTAGTGAACAAGGG + Intergenic
954948109 3:54444339-54444361 GAACCAAGACTTGAGAAATAAGG - Intronic
956628639 3:71292012-71292034 TACCCAAGACTTTTAAAAAATGG - Intronic
957350050 3:79012932-79012954 TAATCAAGAATTGTAAAGAATGG + Intronic
957710676 3:83855010-83855032 TAACCAAGAGTTTTAAATAAAGG - Intergenic
959739744 3:109703963-109703985 TAACTAAAACTTGTGAGAAATGG - Intergenic
960899352 3:122539262-122539284 TAACCCAGACTTGGGAAGTCAGG - Intronic
961365937 3:126399205-126399227 TAAGCAACACAGGTGAAGAAGGG - Intronic
964896995 3:161610414-161610436 CAACCAACAATTGTGAAGAAAGG + Intergenic
965948265 3:174269340-174269362 TTACCAAGAGCTGTGGAGAAAGG - Intronic
965981442 3:174696884-174696906 TAAGCAAGACTTGCTAAGAACGG - Intronic
966981847 3:185144165-185144187 TAACCAGGACATTTGAGGAAGGG + Intronic
970295038 4:14620224-14620246 TAGCCAAGTGTTGTGGAGAAAGG + Intergenic
970810240 4:20084701-20084723 AAACCAAGACTTCTGAGGAGGGG + Intergenic
971894358 4:32572598-32572620 TAACCAAGGTTTCTGAAAAAAGG + Intergenic
973190837 4:47383606-47383628 TAACTGAGAGATGTGAAGAATGG + Intronic
973728522 4:53800763-53800785 TAACCTAAACATGTGAAAAATGG + Intronic
976588457 4:86824987-86825009 TGACTAAGACTTGTGCTGAATGG - Intronic
976701998 4:87979958-87979980 CCATCAAGACTAGTGAAGAATGG + Intronic
977290996 4:95164060-95164082 GAACCATGACTTATGAAGACTGG + Exonic
978547119 4:109882560-109882582 TAACCAACAAATGTGAAGTAAGG + Intergenic
978635490 4:110800118-110800140 AAAGCAAGACTGGTGGAGAAAGG + Intergenic
978642837 4:110891765-110891787 TAACCAATCCTTGTGGAGCAGGG - Intergenic
979945461 4:126825859-126825881 TAAGAAAGACCTGTGAAGAATGG - Intergenic
986636882 5:9831771-9831793 GAGGTAAGACTTGTGAAGAAAGG - Intergenic
988876629 5:35454287-35454309 TAAATATGACTTGTGAAGAATGG + Intergenic
989614943 5:43329963-43329985 TAACCATGCCTAGGGAAGAAAGG + Intergenic
990849150 5:60182148-60182170 AAACTAAGAATAGTGAAGAAAGG + Intronic
992738793 5:79751791-79751813 AAACAAAGCCTAGTGAAGAATGG + Intronic
997377554 5:133408243-133408265 TATCCAAAACTTGGGAATAAGGG - Intronic
998753865 5:145353983-145354005 TGACCAAGAGTTAGGAAGAAAGG + Intergenic
1001431519 5:171666332-171666354 TTAGGAAGACTGGTGAAGAATGG + Intergenic
1001573162 5:172744157-172744179 TAAACAAGACAAGTGAATAAAGG + Intergenic
1002986561 6:2194794-2194816 TAACCAAGAGTTTTAAACAATGG - Intronic
1008011828 6:46475997-46476019 TAAGTAACACTGGTGAAGAAGGG + Intronic
1009292809 6:61905169-61905191 TAACAAAGACTCATGAAGATGGG + Intronic
1009799038 6:68509534-68509556 TAGCAAAGCTTTGTGAAGAATGG + Intergenic
1011773154 6:90697144-90697166 TAAACAAGAGTTGTGGGGAATGG + Intergenic
1012655593 6:101815902-101815924 TAACTAATACTTGTGAATATAGG + Intronic
1013349748 6:109294413-109294435 TAACCAGCACTTCAGAAGAATGG - Intergenic
1013879565 6:114879537-114879559 TAAGCAAGACTTTTTAATAAGGG - Intergenic
1014283532 6:119468070-119468092 TAACCAAAATTTGTTAAGAATGG - Intergenic
1014697985 6:124647958-124647980 ATACCAATACTTGTTAAGAATGG + Intronic
1018241547 6:161780258-161780280 AAACCAGGATTTGTGAAAAATGG + Intronic
1020207153 7:6127644-6127666 TAACAAGGACTTGTGTAGAGTGG - Intronic
1021272703 7:18610724-18610746 TTACGATGGCTTGTGAAGAAAGG - Intronic
1022996614 7:35762276-35762298 TAACCCAGGCTTGTGATGCATGG - Intergenic
1027776772 7:82475033-82475055 TAATCAAGTCTTTTTAAGAATGG - Intergenic
1029103302 7:98152577-98152599 TATCTAAGCCTTGTGAAGACAGG - Intronic
1030213268 7:107017630-107017652 AAAACAAGGCTTCTGAAGAAAGG - Intergenic
1042408817 8:68438337-68438359 TAATAAAGACTTCTGAAGATTGG + Intronic
1042707952 8:71681437-71681459 TAACCATGATTTGAGTAGAAGGG - Intergenic
1042848898 8:73195785-73195807 TAACCAAGAATTATTTAGAAGGG - Intergenic
1044009509 8:86975873-86975895 TAACCAAGTGTTGGTAAGAATGG - Intronic
1045700077 8:104856092-104856114 TAACCAACAGTTATGTAGAAGGG - Intronic
1047664813 8:127079989-127080011 TAACCCAGACTGGTAGAGAAAGG + Intergenic
1053093454 9:35301994-35302016 TGACCAAGACTTCTAAAAAATGG - Intronic
1056347632 9:85715274-85715296 CAAACAAGAATTCTGAAGAAGGG + Intronic
1059857418 9:118415273-118415295 TAACCAAGACACGTAAACAAGGG - Intergenic
1060126903 9:121055964-121055986 TATCTAAGACTTGGGAAGATAGG - Intergenic
1186184800 X:7010304-7010326 AAATCAAGCCCTGTGAAGAATGG - Intergenic
1186557874 X:10579702-10579724 TAACCAGGAGTTGTGAATAAGGG - Intronic
1186776601 X:12871334-12871356 TAACCAAGCACTGTGAATAAGGG - Intronic
1187404980 X:18995678-18995700 CAACCAGGACCTGTGGAGAAAGG + Intronic
1188214688 X:27461673-27461695 GAACAAAGACTTGCTAAGAAAGG - Intergenic
1191978460 X:66899710-66899732 TGACCAAGACTTGAGATGAAGGG - Intergenic
1193484847 X:82074529-82074551 GAACAAAGACTTATGAAGAGAGG + Intergenic
1200757952 Y:7009055-7009077 AAACCAGGGCTTGGGAAGAAAGG - Intronic