ID: 941411590

View in Genome Browser
Species Human (GRCh38)
Location 2:165163323-165163345
Sequence CAAATCTGTTAGTAAAGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941411587_941411590 14 Left 941411587 2:165163286-165163308 CCATTTTTGAACTACATCTGCAG No data
Right 941411590 2:165163323-165163345 CAAATCTGTTAGTAAAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941411590 Original CRISPR CAAATCTGTTAGTAAAGCCA TGG Intronic
No off target data available for this crispr