ID: 941413280

View in Genome Browser
Species Human (GRCh38)
Location 2:165186958-165186980
Sequence AGCACCCCTGTCCCAACCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941413280_941413287 20 Left 941413280 2:165186958-165186980 CCTAGGGTTGGGACAGGGGTGCT No data
Right 941413287 2:165187001-165187023 GATCCATTTAGTCTTTCTGAAGG No data
941413280_941413281 -10 Left 941413280 2:165186958-165186980 CCTAGGGTTGGGACAGGGGTGCT No data
Right 941413281 2:165186971-165186993 CAGGGGTGCTCCCCCTTCTTTGG No data
941413280_941413289 28 Left 941413280 2:165186958-165186980 CCTAGGGTTGGGACAGGGGTGCT No data
Right 941413289 2:165187009-165187031 TAGTCTTTCTGAAGGCATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941413280 Original CRISPR AGCACCCCTGTCCCAACCCT AGG (reversed) Intronic
No off target data available for this crispr