ID: 941414324

View in Genome Browser
Species Human (GRCh38)
Location 2:165200625-165200647
Sequence TTGATTAGGCAGATCTGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941414324_941414327 -2 Left 941414324 2:165200625-165200647 CCCTCTCAGATCTGCCTAATCAA No data
Right 941414327 2:165200646-165200668 AAGAGTCCATTAAGTCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941414324 Original CRISPR TTGATTAGGCAGATCTGAGA GGG (reversed) Intronic
No off target data available for this crispr