ID: 941417412

View in Genome Browser
Species Human (GRCh38)
Location 2:165238544-165238566
Sequence AAAATGGTGTTGTAAAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 596
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 559}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941417405_941417412 30 Left 941417405 2:165238491-165238513 CCATGGACAGCGTTACTGCAATA 0: 1
1: 0
2: 0
3: 3
4: 49
Right 941417412 2:165238544-165238566 AAAATGGTGTTGTAAAAAAGTGG 0: 1
1: 0
2: 2
3: 34
4: 559

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941417412 Original CRISPR AAAATGGTGTTGTAAAAAAG TGG Intergenic
905065073 1:35173439-35173461 ATAATGGTGTTTTCAACAAGTGG - Intergenic
905161613 1:36040761-36040783 AAATTAGTTTTTTAAAAAAGTGG + Intronic
907380735 1:54085605-54085627 AAAATGCTATTTTGAAAAAGAGG - Intronic
907829879 1:58054810-58054832 AAATTGCTGTTTTAAAAACGAGG + Intronic
908352047 1:63295802-63295824 AAAAGTGAGTTGTAGAAAAGTGG + Intergenic
908431552 1:64063557-64063579 AAAATAATTTTTTAAAAAAGAGG - Intronic
909321464 1:74292334-74292356 AAAATGCTGTTAGAAAAAAAAGG - Intronic
909430819 1:75585699-75585721 AAAATGGTGTTAAAAAAGAAGGG - Intronic
909742443 1:79046911-79046933 AAAATGTTGTTTTAAAATATTGG + Intergenic
910653698 1:89598721-89598743 AAAATGGCTTTTTGAAAAAGTGG + Intergenic
911138759 1:94473608-94473630 AACATGTTTTTGCAAAAAAGTGG + Intronic
911553881 1:99318675-99318697 AAAATAATTTTGTAAAAATGTGG + Intergenic
911937877 1:104003710-104003732 TAAATGGTGTTGGAAAAACTAGG + Intergenic
912003890 1:104870786-104870808 AAAATTGTGTTGAACCAAAGAGG + Intergenic
912114426 1:106387574-106387596 AAAATAGTGTTGTAAAGAATTGG - Intergenic
912318131 1:108685144-108685166 AAAATGGTGTTGGAAAGACCAGG - Intergenic
912711067 1:111950346-111950368 AAGGTGGTGTTGTCAAACAGTGG - Intronic
912834064 1:112979946-112979968 AAAATGTCGTTGTCAAAAAATGG + Intergenic
913417907 1:118632406-118632428 AAAATGGTAATGAAAAAAATTGG - Intergenic
913572682 1:120136725-120136747 AAAATGGTCTTTTCAACAAGTGG + Intergenic
914293525 1:146297639-146297661 AAAATGGTCTTTTCAACAAGTGG + Intergenic
914554569 1:148748422-148748444 AAAATGGTCTTTTCAACAAGTGG + Intergenic
915729670 1:158044209-158044231 AAAAGGCAGCTGTAAAAAAGTGG + Intronic
916389137 1:164311302-164311324 GGAATGGTGATGTAAAATAGTGG - Intergenic
916437330 1:164789297-164789319 AAGATGGTGTTTTAAAAAGATGG + Intronic
917069314 1:171132441-171132463 TAAATGGTGTTGGAAAAAATTGG + Intergenic
917093811 1:171380690-171380712 AAGATGGTGGTTTAAAAATGGGG + Intergenic
917697328 1:177539220-177539242 AGAATGGTGTGGTACAAAAATGG + Intergenic
917708231 1:177656690-177656712 AAAATGCTGTGGGAAAAAACTGG - Intergenic
918032808 1:180832612-180832634 TAAATGGTGTTGGAAAAACTGGG - Intronic
918522972 1:185435135-185435157 AAAATGATGTTGTAGAATACTGG - Intergenic
918702520 1:187622777-187622799 AAAATGGTAGAGTAAAAAAAGGG + Intergenic
918737985 1:188090759-188090781 AAAAGGATGTTCTGAAAAAGAGG - Intergenic
918851823 1:189701333-189701355 AAAGTGGTCTTGTATGAAAGAGG - Intergenic
919109922 1:193205962-193205984 GAAATGGTATTATATAAAAGGGG + Intronic
919337756 1:196261562-196261584 AAAATGGGGATGAAAAAGAGAGG + Intronic
920188257 1:204175885-204175907 AAAGTGGAGGAGTAAAAAAGGGG + Intergenic
920219824 1:204388769-204388791 AAAATTCTTTTGTAAAAATGAGG - Intergenic
920744362 1:208612481-208612503 AAAATGATGGTGTTAGAAAGTGG - Intergenic
921198532 1:212780661-212780683 AAAATGGCTTAGTAAGAAAGTGG - Intronic
922076437 1:222249433-222249455 AAAATGTTTTTGTAAAGATGTGG + Intergenic
922820855 1:228484468-228484490 AAAATTGGGTTGTAAAAAATTGG - Intergenic
923050165 1:230385748-230385770 AAAATCAGGTTATAAAAAAGAGG - Intronic
923733202 1:236574318-236574340 AAAATGGTTTTGTAATCTAGAGG + Exonic
924947204 1:248854692-248854714 AAAATGGGATTCTAAAGAAGGGG - Intronic
1065138187 10:22693265-22693287 AAAATGAAGTTGTAAAGATGGGG - Intronic
1065295641 10:24271946-24271968 AAAATGGAGATGCATAAAAGTGG - Intronic
1065533106 10:26692469-26692491 AATATGCTTTTGTGAAAAAGAGG - Intergenic
1065565111 10:27000392-27000414 AGAATGATGTTGAATAAAAGGGG - Intronic
1065597073 10:27324564-27324586 AATATGCTTTTGTGAAAAAGAGG + Intergenic
1065646239 10:27836853-27836875 GAAATGGTGTTGAAACACAGAGG + Intronic
1066442450 10:35451228-35451250 AACTTGTTTTTGTAAAAAAGGGG - Intronic
1068224933 10:54095812-54095834 AAAATTTTGTTGTACAAAATGGG + Intronic
1068477330 10:57545552-57545574 AAAATAGTACTGTAAGAAAGAGG + Intergenic
1069131997 10:64717004-64717026 AATATTATGTTGTAAAAAATGGG - Intergenic
1069208276 10:65721250-65721272 AAAATATTGTTTTAAAAAAAAGG - Intergenic
1069210716 10:65756243-65756265 CAAATGGTGTTGGAACAAATAGG - Intergenic
1070306398 10:75241908-75241930 AAAATTGTTTTGTAGAGAAGGGG - Intergenic
1071223733 10:83500917-83500939 TAAATGATGTTATAAAAATGAGG + Intergenic
1071533168 10:86404353-86404375 AAAATGGACGTATAAAAAAGTGG + Intergenic
1071889786 10:89991318-89991340 TAAATGGTGTTGGAAAAAATGGG + Intergenic
1072039829 10:91596400-91596422 AAATTGGTTTTTTAAAAAATCGG - Intergenic
1072356303 10:94615148-94615170 AATATGTTGTTTAAAAAAAGAGG - Intergenic
1072362807 10:94676653-94676675 AAAAGGGTGTTGTAGGCAAGAGG - Intergenic
1072923572 10:99596779-99596801 AAAATGGTTTTGTAGAAATGAGG - Intergenic
1072963264 10:99950145-99950167 AAGATGGTGTTTTGAAAAACGGG + Intronic
1073173488 10:101533964-101533986 AAAATGATATTCTATAAAAGGGG + Intronic
1073369421 10:102973824-102973846 ATGATGTTGTTTTAAAAAAGGGG - Intronic
1073638600 10:105225321-105225343 AAAATGGTATTTTCAAAAAATGG - Intronic
1073985485 10:109203545-109203567 AAAATGGAGTTTAAAAATAGGGG + Intergenic
1074332398 10:112528529-112528551 AAAAGGGTGATGTGATAAAGGGG + Intronic
1074444846 10:113513196-113513218 AAAATGCTTTGGTAAATAAGGGG - Intergenic
1074978591 10:118600918-118600940 AAAATGATGTTTTAAAAAAGAGG + Intergenic
1075333084 10:121588476-121588498 AAGATGGTGTGGTAAAGATGGGG + Intronic
1075579752 10:123608347-123608369 AAAATGGAGATGGAAAGAAGAGG + Intergenic
1076518650 10:131065122-131065144 TAAATGCTGTTATTAAAAAGGGG - Intergenic
1079708772 11:23653846-23653868 AAAATGATGTAATAAATAAGTGG + Intergenic
1080190994 11:29549112-29549134 AATATGGTGTTGTTAATAATAGG + Intergenic
1080206952 11:29740396-29740418 AAAATAGCATTTTAAAAAAGTGG - Intergenic
1080288588 11:30644890-30644912 AAAATTCTCTTGTAAAAGAGAGG + Intergenic
1080330883 11:31136768-31136790 AAATTGGTGTTAGACAAAAGGGG - Intronic
1080603701 11:33845787-33845809 AAAATATTTTTATAAAAAAGTGG - Intergenic
1080970743 11:37272882-37272904 AAAATGATGTTGAAAAGGAGTGG + Intergenic
1081161136 11:39750110-39750132 AAAATGAAGTTGCAAACAAGAGG - Intergenic
1081330798 11:41797320-41797342 AAAATTGTTTTTTAAAAAATTGG - Intergenic
1082720379 11:56667900-56667922 AAACTGGAGATGTAAAAGAGTGG - Intergenic
1085862530 11:80251318-80251340 AAAATGATGTTATGATAAAGAGG + Intergenic
1085866148 11:80296010-80296032 AAAATTGGGTTTTAAAAAAGTGG + Intergenic
1085891884 11:80589495-80589517 AAAATGATTTTCTAAAATAGTGG - Intergenic
1085924550 11:81000376-81000398 GAAATGGTATAGTAAAAATGGGG - Intergenic
1086114381 11:83231777-83231799 TAAATGGTGCTGGAAAAAACTGG - Intronic
1086728120 11:90214808-90214830 AAAGTGGTTTTATATAAAAGTGG + Intronic
1088017121 11:105074374-105074396 AAAATGGAGATGTCAAAAACTGG + Intronic
1088281945 11:108143966-108143988 CAAATGCTGTTTAAAAAAAGGGG - Exonic
1088979086 11:114845348-114845370 AAAATGTTGTTTTAAAATAGAGG + Intergenic
1089594583 11:119569225-119569247 AAAACTGTTTTTTAAAAAAGGGG - Intergenic
1092738680 12:11608150-11608172 ACAAAGGTGATGTTAAAAAGAGG + Intergenic
1093079974 12:14798789-14798811 AAAATGCTATTTTACAAAAGTGG + Intronic
1093236582 12:16615877-16615899 AAAAGGGTGAGGTACAAAAGAGG + Intergenic
1094321367 12:29187201-29187223 AAATTGATATTGTAAAAAAAAGG - Intronic
1094725585 12:33112073-33112095 ACAATGCAGTTGTAAAAATGCGG + Intergenic
1094746339 12:33348444-33348466 TAAATGGTGTTGGGAAAAACTGG + Intergenic
1095683092 12:45001436-45001458 AAGAAGCTGTTGTAACAAAGGGG + Intergenic
1096066499 12:48744896-48744918 GCAATGGTGATGTACAAAAGAGG + Intergenic
1096649708 12:53056046-53056068 AACAGGGTGGTGTAAAACAGTGG + Intronic
1096739445 12:53681657-53681679 AGAATGGTTTTTTAAAAAGGAGG - Intergenic
1097819604 12:64115163-64115185 AAAATGAATTTGTAAAAAACTGG + Intronic
1097874032 12:64626735-64626757 AAAATGTTTTTGTAGAAATGGGG + Intronic
1097966503 12:65587159-65587181 AAAATCTTGTTTCAAAAAAGAGG + Intergenic
1097989649 12:65822102-65822124 AATATGGTGTGATAAAGAAGAGG + Intergenic
1098048206 12:66424567-66424589 AAAATGGTATTGGGAAAATGGGG - Intronic
1098125115 12:67283291-67283313 AAAATGGTGTTGTATGGGAGTGG + Intronic
1098211434 12:68170164-68170186 AAAATGATGTTGATAAAATGTGG + Intergenic
1099138684 12:78942024-78942046 ACAATGAAGTTGTACAAAAGAGG - Intronic
1099187211 12:79528691-79528713 AAAATGGTGTGGTAAAAATACGG - Intergenic
1099535819 12:83843017-83843039 AAATTGGTGGTGGATAAAAGAGG - Intergenic
1099643554 12:85321341-85321363 CAAAAGGTGTTGTATAAAATAGG + Intergenic
1099883611 12:88499975-88499997 AAAATGGTGTAGGAAAGATGTGG - Intronic
1100176287 12:92034592-92034614 AAAATGAGGGTGTAAAACAGTGG - Intronic
1100920193 12:99475591-99475613 AAAATGGAATTATAAAAAAATGG - Intronic
1101506796 12:105354597-105354619 AAAATGTTGTTGAAAAAATTTGG + Intronic
1102142852 12:110630696-110630718 TATATGGTGTTGTATAGAAGTGG + Intronic
1104082271 12:125440372-125440394 AAAATGCTGTTGTTAAATATTGG + Intronic
1104798710 12:131538239-131538261 AATATGGAATTGTAATAAAGGGG + Intergenic
1105035140 12:132913955-132913977 AAAATAGTGGTTTAAAAAAATGG - Intronic
1105414531 13:20197896-20197918 GAAATGGTGTTGTTACTAAGAGG + Intergenic
1106798316 13:33230569-33230591 GAAAGGGTGATGAAAAAAAGTGG - Intronic
1106852092 13:33804801-33804823 AAAATGGGGTAGGACAAAAGGGG + Intergenic
1107192577 13:37607271-37607293 TAAATGGTGTTGGGAAAAACTGG + Intergenic
1107275487 13:38673764-38673786 AAAATGGTGTTGGATAATGGTGG + Intergenic
1107578705 13:41757371-41757393 AAAATAGTGTGGTAAAAATTTGG + Intronic
1108305618 13:49129144-49129166 AAAATAGTGTTTTAAATGAGTGG + Intronic
1108727365 13:53197784-53197806 AAAACGGTGTTTTAATAAGGTGG + Intergenic
1109527070 13:63589508-63589530 AAAATGTTTTTTTAAAAAAGAGG - Intergenic
1109809212 13:67488932-67488954 AAAATGGTGGTTTAATTAAGAGG + Intergenic
1110225244 13:73112805-73112827 ATTATGGTGTAGAAAAAAAGGGG + Intergenic
1110444290 13:75560372-75560394 GAAATGGAGTTTGAAAAAAGAGG + Intronic
1110513731 13:76384026-76384048 AAATTGCTTTTGCAAAAAAGAGG + Intergenic
1110631749 13:77716150-77716172 TAAATGGTGTTGGAACAAAATGG - Intronic
1110860197 13:80339415-80339437 AAAATGGCTTTTTAAAAAAAGGG + Exonic
1111019544 13:82429939-82429961 AAAATGGTATTGAAAAAGACAGG + Intergenic
1111057009 13:82964372-82964394 TAAATGGTGTTAAAAAAAAAAGG - Intergenic
1111842101 13:93462487-93462509 AAAATTATGTTTTTAAAAAGCGG + Intronic
1112347707 13:98604579-98604601 GAAATAGTGTTGAAAAAAATGGG + Intergenic
1113155605 13:107317352-107317374 AGAATGGTTTTGTTAAAAATCGG - Intronic
1114399166 14:22393810-22393832 AAAATGCTGTTAAAAAAAAAAGG + Intergenic
1114857672 14:26468944-26468966 AAAATGGTTTTGTTAATCAGTGG - Intronic
1115084848 14:29502172-29502194 AAAATAGTGTAAGAAAAAAGAGG + Intergenic
1116053610 14:39835957-39835979 AAAATGCTGATATTAAAAAGTGG - Intergenic
1116496929 14:45572308-45572330 TAAATGATTTTGTAAAAAAGTGG + Intergenic
1116604651 14:46974584-46974606 AAAATTATTTTGTACAAAAGAGG + Intronic
1117126609 14:52634357-52634379 GAAATGGTTTTGTAACAAGGAGG - Intronic
1117487072 14:56208804-56208826 AAAATGGTTTTCTATGAAAGTGG - Intronic
1117838168 14:59829289-59829311 AACATGCTGTTGCACAAAAGTGG + Intronic
1120082502 14:80231449-80231471 AAATTGGTCTTGTAAGAAAGAGG - Intronic
1202928496 14_KI270725v1_random:16530-16552 AAAATGGAGTTGTTAAGAGGTGG - Intergenic
1123973651 15:25532096-25532118 AAAATGATCTTGTGAAAACGCGG - Intergenic
1124058907 15:26269341-26269363 TAAAGGGTGTTGGAAAAAAATGG - Intergenic
1124340816 15:28888139-28888161 AACATTTTGTTGAAAAAAAGAGG - Intronic
1124622497 15:31282174-31282196 TAAATGAGGTTGTAAAAATGGGG - Intergenic
1124827500 15:33113498-33113520 AAACTGTTGTTGGAAAAAAGAGG - Intronic
1125214084 15:37249587-37249609 ATAATGTTGTTAGAAAAAAGGGG - Intergenic
1125306246 15:38319140-38319162 AAATTGGAATTGTTAAAAAGGGG - Intronic
1126208016 15:46068473-46068495 AAACTGTTGTAGTAAAAAAAGGG + Intergenic
1127656312 15:61059480-61059502 ACAATGGTCTTGTAATAAATAGG - Intronic
1127710524 15:61593024-61593046 CAACTGGTGTTTAAAAAAAGGGG - Intergenic
1129498227 15:76007915-76007937 AAAATAATTTTTTAAAAAAGGGG - Intronic
1129946855 15:79545949-79545971 CAAATGGTGTTGTAAACAGATGG - Intergenic
1130714158 15:86315138-86315160 AAAATGGCATTGTATAAAATGGG - Intronic
1130792600 15:87171693-87171715 AAAATTTTGTTGGAAAAAAATGG - Intergenic
1130793127 15:87177905-87177927 AAAAAGGTGAGGGAAAAAAGGGG + Intergenic
1130827884 15:87568094-87568116 AAACCGGTGTTGTCAATAAGAGG - Intergenic
1130950663 15:88584454-88584476 CAAATGGTGATGGAAAAAATGGG + Intergenic
1131239380 15:90725481-90725503 AAAAAGGGACTGTAAAAAAGAGG - Intronic
1134258895 16:12634622-12634644 AAAAGGATGTTCTAAAAATGTGG - Intergenic
1134525934 16:14943475-14943497 TAAATGGAATTGTTAAAAAGTGG - Intronic
1134546473 16:15112887-15112909 TAAATGGAATTGTTAAAAAGTGG + Intronic
1134555716 16:15162595-15162617 AAAATGGTTTTGTTAATCAGTGG + Intergenic
1134581187 16:15372162-15372184 TAAATGGAATTGTTAAAAAGTGG + Intronic
1134713513 16:16341963-16341985 TAAATGGAATTGTTAAAAAGTGG - Intergenic
1134721383 16:16385321-16385343 TAAATGGAATTGTTAAAAAGTGG - Intronic
1134916298 16:18074303-18074325 AAAATGGTTTTGTTAATCAGTGG + Intergenic
1134946043 16:18326563-18326585 TAAATGGAATTGTTAAAAAGTGG + Intronic
1134953306 16:18366707-18366729 TAAATGGAATTGTTAAAAAGTGG + Intergenic
1135595322 16:23737732-23737754 AAAATGAAGCTGTAAGAAAGAGG - Intergenic
1135715015 16:24756382-24756404 AAAAACCTGTTTTAAAAAAGTGG + Intronic
1138372315 16:56536928-56536950 AAAATGGTGCTGTGGAAAACAGG + Intergenic
1139650732 16:68360957-68360979 AAAATCGTGTTGTGAAAGAATGG + Exonic
1139834906 16:69830438-69830460 AAACTGGCTTTGTAAAAATGAGG + Intronic
1139856502 16:69984822-69984844 TAAATGGAATTGTTAAAAAGTGG + Intergenic
1140561158 16:75983429-75983451 AAAAGGGTGATGAAAAACAGGGG - Intergenic
1140779956 16:78285901-78285923 AAACTGGTGAAGTAATAAAGAGG - Intronic
1142770556 17:2093791-2093813 AAAATTGTTTTGTAAAGATGAGG + Intronic
1143396312 17:6600897-6600919 AAAATGGTGCTGGAAAACAAAGG + Intronic
1146019247 17:29262223-29262245 AAAATGGACATTTAAAAAAGGGG + Exonic
1146866470 17:36339248-36339270 AAAATGTTGATGTAATAAATGGG + Intronic
1147069340 17:37939852-37939874 AAAATGTTGATGTAATAAATGGG + Intergenic
1147080868 17:38019392-38019414 AAAATGTTGATGTAATAAATGGG + Intronic
1147096811 17:38143349-38143371 AAAATGTTGATGTAATAAATGGG + Intergenic
1147227516 17:38991099-38991121 CAAATGGTGTTGGGAAAAACTGG - Intergenic
1147705929 17:42424644-42424666 AAAAAGCTTTTGGAAAAAAGAGG - Intergenic
1147706217 17:42426699-42426721 AAAAAGCTTTTGGAAAAAAGAGG + Intergenic
1149844997 17:60003628-60003650 AAAATGTTGATGTAATAAATGGG - Intergenic
1149878508 17:60263902-60263924 ACAATGGTGTTATTAAATAGAGG - Intronic
1150023508 17:61646267-61646289 AATATGTTGTAGTAAAAATGTGG + Intergenic
1150695403 17:67400744-67400766 AAAATGGGCATGTTAAAAAGAGG - Intronic
1150897318 17:69227828-69227850 TAAATGGAGATTTAAAAAAGAGG - Intronic
1151040655 17:70856810-70856832 AAAACAGTGTTTTAAAGAAGTGG + Intergenic
1153102559 18:1490110-1490132 AAAATGATCTTGTCAAAAAAAGG - Intergenic
1153315154 18:3714113-3714135 AAATTGTTTTTTTAAAAAAGGGG - Intronic
1153538074 18:6124306-6124328 AAAATGGTCTCGTACAAAGGAGG + Intronic
1153547212 18:6220030-6220052 TAAATTGTGTTTTAAAATAGAGG - Intronic
1153647643 18:7209436-7209458 AAAATTATTTTTTAAAAAAGAGG - Intergenic
1154033956 18:10780221-10780243 AAAATCGTGTTGTCAGATAGTGG - Intronic
1154117976 18:11628085-11628107 TAAATGGAATTGTTAAAAAGTGG + Intergenic
1155149801 18:23113871-23113893 TAAATGGTTTTCTAAAAAAATGG - Intergenic
1155635738 18:27953084-27953106 AAACTGGTATTTTAAAAAATAGG + Intronic
1156167553 18:34440756-34440778 AAAATGCTGTCTTAACAAAGTGG - Intergenic
1156171213 18:34488555-34488577 AAAATTGTGTAGTAAATATGTGG - Intergenic
1157087000 18:44591134-44591156 AAAATGTGGATGTAAATAAGGGG - Intergenic
1157223685 18:45844546-45844568 AAAAATGTTTTTTAAAAAAGAGG + Intergenic
1157457015 18:47841075-47841097 AAAATGGGAATGGAAAAAAGAGG + Exonic
1157840610 18:50954985-50955007 ATGATGGAGTTGTCAAAAAGTGG - Intergenic
1157936564 18:51879781-51879803 CAGATGGTGTTGTCAAATAGAGG + Intergenic
1157987892 18:52460383-52460405 AAGAAAGTGTTGAAAAAAAGAGG - Intronic
1158130138 18:54143587-54143609 TAAATGGTGTTGGGAAAAAATGG - Intergenic
1158676138 18:59519896-59519918 TAAATGGAGTTGGAAAAAACTGG - Intronic
1158775021 18:60567636-60567658 GAAATTGTGTGATAAAAAAGAGG + Intergenic
1158935516 18:62361074-62361096 AAAAAGTTATTTTAAAAAAGAGG + Intronic
1158994095 18:62899508-62899530 AGAATGGTTTTTTAAAAAAGAGG - Intronic
1161460295 19:4392639-4392661 AAAGTGAGGTTTTAAAAAAGAGG + Intronic
1162832649 19:13296474-13296496 AAAATGTCGTTATGAAAAAGAGG + Intronic
1163227374 19:15973885-15973907 AAAATGGTGCTATTAAAACGAGG - Intergenic
1163415466 19:17183792-17183814 AAAATGGTTTTGTGAACAAAAGG - Intronic
1163769612 19:19182960-19182982 ATAATGGGGGTGTAAAAAATAGG + Intronic
1165299915 19:34962119-34962141 ACAATGATGTTAAAAAAAAGAGG - Intronic
1166435033 19:42760444-42760466 AAAAGAGTGGGGTAAAAAAGTGG - Intronic
1166618719 19:44275565-44275587 AGAAAGGTTTTGCAAAAAAGGGG + Intronic
925027973 2:624565-624587 CAAATGGAATTGTACAAAAGTGG + Intergenic
925609035 2:5688626-5688648 AAAAAGGTGTTTTATAAAATAGG + Intergenic
925861345 2:8179517-8179539 AAAATGTGGATGTAAAAAAATGG + Intergenic
926384996 2:12327247-12327269 AAAATATTGTAGAAAAAAAGTGG + Intergenic
927868347 2:26607437-26607459 AAAATGGTAATGTACAAACGTGG - Intronic
927908250 2:26877271-26877293 AAAATATTGTTATAATAAAGTGG - Intronic
928630709 2:33188930-33188952 AAAATGCTTTTTTAAAAAAAAGG + Intronic
929034999 2:37682164-37682186 AAAATGGTTATTTAAAATAGAGG + Intronic
929066421 2:37980110-37980132 AAAATGCTTTTCTAAATAAGTGG - Intronic
929353967 2:40996803-40996825 AAAATTGTGTTCCAAAAAATTGG - Intergenic
929475653 2:42244917-42244939 AAGATGATGTTGTAAAAATAGGG + Intronic
929818169 2:45252427-45252449 AAAATCATGTTATAAAATAGGGG + Intergenic
930324235 2:49894642-49894664 AAAATGAAGTTGTAAATAATAGG - Intergenic
931004679 2:57834912-57834934 AAAAAGGAATTTTAAAAAAGAGG + Intergenic
931167286 2:59761687-59761709 ATAAAGGTGTTATGAAAAAGAGG + Intergenic
931324077 2:61200225-61200247 AAAATGTTTTTGTAGAGAAGGGG + Intronic
932545961 2:72710027-72710049 AAAATGGAGTTGTGAACAATTGG + Intronic
932578411 2:72976216-72976238 AAAATTCTGGTGTAAAAAAGTGG - Intronic
932583918 2:73010456-73010478 AAAATGGTGGTGTAGAAAAATGG + Intronic
933308376 2:80630291-80630313 GAAAAGGTTTTCTAAAAAAGCGG - Intronic
936925974 2:117737272-117737294 AAAAAGGTGATGTAGAAAGGAGG - Intergenic
937030249 2:118732919-118732941 AAAATTGTGTTGAAGAAAACAGG - Intergenic
937343676 2:121109204-121109226 AAAATTGTTTTGTAAAAAGCAGG + Intergenic
937602095 2:123750670-123750692 AAAATGGTATTAAAATAAAGAGG + Intergenic
937602223 2:123752385-123752407 AAAAAGGTATTTTACAAAAGTGG + Intergenic
937628611 2:124072692-124072714 AAAATATTGATGAAAAAAAGAGG + Intronic
937887064 2:126907233-126907255 AAAATGGTGGTGAAAAGAAATGG - Intergenic
938252313 2:129825625-129825647 AAAATTTTGTTTCAAAAAAGTGG + Intergenic
938633098 2:133190687-133190709 TAAATGGTGCTGGAAAAAACTGG + Intronic
939090540 2:137775539-137775561 AAAATGTGATTGGAAAAAAGGGG + Intergenic
939926223 2:148176974-148176996 AAAATACTGTGGCAAAAAAGAGG - Intronic
939931186 2:148235774-148235796 AAAATAGTTTTCTAAAAAAGGGG + Intronic
941270475 2:163421014-163421036 AAAATCCTGATGTAAACAAGTGG + Intergenic
941417412 2:165238544-165238566 AAAATGGTGTTGTAAAAAAGTGG + Intergenic
941535776 2:166721138-166721160 AAAGTGGTGTAGGAAAAAGGAGG - Intergenic
942584833 2:177464595-177464617 AAAATGATCTTGAAAACAAGTGG - Intronic
942779185 2:179621140-179621162 AGAATGGGGTAGAAAAAAAGGGG + Intronic
943087562 2:183331631-183331653 TAAATGGTGTTGGGAAAAACTGG + Intergenic
943374853 2:187064234-187064256 AAAATGTTGCCTTAAAAAAGAGG + Intergenic
943445197 2:187976629-187976651 AAAATGGTGAAGTTAAAAATTGG + Intergenic
943717476 2:191167980-191168002 AAAATGGTTGTGTAATAAAAGGG + Intergenic
943948979 2:194104875-194104897 AAAATGGTCTTTAATAAAAGGGG + Intergenic
944352365 2:198744086-198744108 AAAATGCTTTAGAAAAAAAGTGG - Intergenic
944675320 2:202030703-202030725 AAAATTGTCTAGTAAAAGAGAGG + Intergenic
945371904 2:209028987-209029009 AAAATGTGGTTGGAAAAAATTGG + Intergenic
945384780 2:209184282-209184304 TAAATGGTGTTGGGAAAATGGGG - Intergenic
945413277 2:209538592-209538614 AAATTGGTTTTGGAAAAATGTGG + Intronic
945747939 2:213742165-213742187 AAAATGCTTTTGTAATAAAAAGG - Intronic
946012666 2:216578810-216578832 AAAATGGTGTGGGAAGCAAGGGG - Intronic
946138312 2:217666475-217666497 AAGATGGTGATGTAGGAAAGAGG + Intronic
946265096 2:218533887-218533909 AAAATGTTTTTGTAAAAACAGGG + Intronic
946687474 2:222285312-222285334 AAAATGCTTTTGAAAGAAAGAGG + Intronic
947172247 2:227323441-227323463 TAAAGGTTGTTGTAACAAAGTGG - Intergenic
947497189 2:230646445-230646467 AAAATGTTTTTGTAGAGAAGGGG - Intergenic
947554188 2:231075179-231075201 AAAATGGGCTTGAAAAGAAGGGG - Intronic
947704827 2:232265718-232265740 AAAATTCAGTTGTAAAACAGGGG + Intronic
947841341 2:233209673-233209695 AAAATGGTGTGGAAAAAGAATGG - Intergenic
948898218 2:240938302-240938324 AAAATGGTGCTGGAAAAACTGGG - Intronic
1168732022 20:92697-92719 AAAATAGTTGTCTAAAAAAGAGG - Intronic
1169106174 20:2996554-2996576 CAAATGATGTCGTAAAAAAGTGG + Intronic
1170154497 20:13257138-13257160 AATATAGTGTTTGAAAAAAGAGG - Intronic
1170373054 20:15670315-15670337 AGGATGGTGTTGTCAAACAGAGG + Intronic
1170593520 20:17788724-17788746 AAAATGATGTTTAAAAAAAATGG - Intergenic
1172261006 20:33565247-33565269 AAAATGATTTTGTAAAAATTTGG + Intronic
1173033629 20:39387515-39387537 AAAATGGTAATGAAAAATAGAGG - Intergenic
1175270808 20:57732729-57732751 ATAATTGCATTGTAAAAAAGAGG - Intergenic
1176590521 21:8645173-8645195 AAAATGGAGTTGTTAAGAGGTGG - Intergenic
1180028432 21:45183099-45183121 AAAATGGCTTTGTAAAGAAAAGG - Intronic
1180273349 22:10622206-10622228 AAAATGGAGTTGTTAAGAGGTGG - Intergenic
1180901021 22:19372887-19372909 AACATGGTTTTGTAAAGATGAGG + Intronic
1182040417 22:27234571-27234593 TAAATGGTGTTGGGAAAAACTGG + Intergenic
1182893392 22:33838336-33838358 AAAAATGTGTTTTAAAAAATTGG + Intronic
1183095468 22:35549366-35549388 AAAATGAGGTTGAAAAAATGAGG - Intronic
949136757 3:576502-576524 AAAATGGAGTTGTTAAGAGGTGG + Intergenic
949662688 3:6298287-6298309 CAAATGGTGTTGGGAAAAACTGG - Intergenic
949730222 3:7102628-7102650 AGAATGGTGTAGAAAAAATGTGG - Intronic
951278884 3:20722602-20722624 AAAAAAGTGTTTTAAAATAGTGG - Intergenic
951692859 3:25415431-25415453 AAAATGGTGCTGGAATAATGAGG - Intronic
951745776 3:25975660-25975682 AAAATGGTGCTTAAAAAAAGAGG - Intergenic
952039307 3:29242148-29242170 AAACTGGTGTGGTAAATCAGAGG + Intergenic
952208776 3:31207974-31207996 AAAATGGTGTTTTCAACAAGAGG - Intergenic
952573331 3:34744119-34744141 AAGAGGATGTTCTAAAAAAGAGG - Intergenic
953247403 3:41207250-41207272 AAAATGGTGTTGCTGATAAGTGG + Intronic
953287376 3:41625361-41625383 AAAATGTGGTTTTAAAAAATCGG + Intronic
954168333 3:48779130-48779152 AAAAATGTTTTGTAAAAATGAGG + Intronic
954986036 3:54792909-54792931 AAAATGCTGTTGCCAAAAGGAGG + Intronic
955244649 3:57213184-57213206 AAAATGGTATAGTAAAAAATTGG - Intronic
955985411 3:64568645-64568667 AAACTGGCGCTGTAAAAGAGGGG - Intronic
956091792 3:65675396-65675418 TAAATGGTGATTTAAAAACGGGG + Intronic
957127401 3:76179557-76179579 AAGATGGTGATGTATAAGAGCGG - Intronic
957907121 3:86571370-86571392 ACAATGTTGTTGCAAATAAGAGG + Intergenic
957961152 3:87255055-87255077 AAAATGATGTTGTAATATATGGG + Exonic
958115990 3:89219148-89219170 AAAATGTTGTTGTGAAAAAATGG - Intronic
958518388 3:95151863-95151885 AAAATACTCTTGTAAGAAAGTGG - Intergenic
958798250 3:98729589-98729611 AAGAGGATGTTGTAAGAAAGTGG + Intergenic
959392887 3:105798217-105798239 AAAATGGAGTTTTAAAAAACAGG + Intronic
959402213 3:105916644-105916666 AAAATAATATTGTAAAAAAAAGG - Intergenic
959460609 3:106621435-106621457 TAAATGGTGTTGAAAGAAAATGG + Intergenic
959599142 3:108159393-108159415 AAAATGGTCTTGCACAACAGGGG + Intergenic
959600424 3:108177035-108177057 AAAATGATGTTATAATATAGTGG - Intronic
959749492 3:109816473-109816495 TATATGGTGTGGGAAAAAAGTGG - Intergenic
960327868 3:116319023-116319045 AAAATAGTGTTGTATAGAATTGG + Intronic
960618445 3:119617306-119617328 ATAATGAGGTTGTAAAAAATTGG + Intronic
960682476 3:120263610-120263632 AAAATAGTGTTGTAAACAGTAGG + Intronic
962137575 3:132752680-132752702 AAAATTGTGTGTTCAAAAAGAGG + Intergenic
962255331 3:133866509-133866531 GAAATGTTGTTTTAAAAATGGGG - Intronic
964723908 3:159794773-159794795 AAAATAGTATTGTAATAAAATGG + Intronic
964912451 3:161799780-161799802 AAAATGGACTAATAAAAAAGGGG - Intergenic
965282965 3:166777318-166777340 AAAATGATCTTGCAAAAAAAAGG + Intergenic
965736254 3:171824172-171824194 AAAGTGTTGTTGGCAAAAAGAGG + Intergenic
965950325 3:174300631-174300653 AAAATGGATTGGTAAAAAGGAGG + Intergenic
966289387 3:178337383-178337405 TAAATGGTATTGTCAAAATGGGG - Intergenic
966445166 3:179994426-179994448 AAAATGGAGGGGTAACAAAGAGG - Intronic
967359438 3:188612860-188612882 AATATGATATAGTAAAAAAGAGG + Intronic
969859872 4:10027378-10027400 AAAATGGGGTGGTAAACAGGAGG - Intronic
970346020 4:15152873-15152895 AAAATGCAGTTGTAATAAAATGG + Intergenic
970540712 4:17076004-17076026 AAAATGGAGTTGGGAAAATGGGG - Intergenic
971108780 4:23558593-23558615 CAAATGGTGTTCAAAACAAGAGG + Intergenic
971523323 4:27583234-27583256 AAAATGGTGTGTGATAAAAGTGG + Intergenic
971543731 4:27857351-27857373 AAAATTATGTTGAATAAAAGTGG + Intergenic
971842821 4:31876278-31876300 AAAATAGTGTTGTGATACAGAGG + Intergenic
971891975 4:32536334-32536356 ATAATGTTGCTTTAAAAAAGGGG + Intergenic
971973300 4:33649498-33649520 TAAATGGTCTTGTAAAACAGTGG - Intergenic
972150212 4:36079925-36079947 AAAATGGTCGTGTAAGAAAGAGG - Intronic
972946051 4:44256976-44256998 AAAATAATGTTGAAAGAAAGAGG + Intronic
973103454 4:46301312-46301334 AAAATGGTTTTGAAAAAGAACGG + Intronic
973605299 4:52580921-52580943 AAAATGGAATTGGAATAAAGGGG + Intergenic
973654766 4:53035241-53035263 TAAATGGTGTTGGGAAAAACTGG + Intronic
973832905 4:54779730-54779752 AAAATGGATGTGGAAAAAAGAGG - Intergenic
974130159 4:57744767-57744789 AATATGATGTTGAATAAAAGTGG + Intergenic
974305870 4:60139267-60139289 AAAATATTTTTGTGAAAAAGTGG - Intergenic
975469907 4:74753834-74753856 AAAATATTGTTCTTAAAAAGTGG + Intronic
975644498 4:76532774-76532796 AGTATGGTGAAGTAAAAAAGTGG - Intronic
976125000 4:81824561-81824583 AAAATGGTGGTCTACAAAATAGG + Intronic
977804556 4:101281393-101281415 AAAATGCTGATGCAGAAAAGAGG + Intronic
978890866 4:113825761-113825783 GAAAAGGTGTTGTGAGAAAGAGG + Intergenic
979733378 4:124052400-124052422 AGAATGGTGTAGAAGAAAAGAGG + Intergenic
979754042 4:124317440-124317462 AATACTGTGTTGAAAAAAAGTGG - Intergenic
980016830 4:127659491-127659513 AAAATGTTGATTTAAAGAAGAGG + Intronic
980560796 4:134472361-134472383 AAAATGTTTTTTTAAAAAAGAGG + Intergenic
980764803 4:137287894-137287916 AAAAATGGGTTGTAAAACAGTGG + Intergenic
980783354 4:137520575-137520597 AAAAAGTTATTGAAAAAAAGTGG + Exonic
981068948 4:140514678-140514700 AAAATTAGGTTGTAATAAAGAGG - Intergenic
981693077 4:147531123-147531145 AAAATAGTGAAGTAAAAAATAGG + Intronic
981789207 4:148517191-148517213 TAAATGGTGTTGGGAAAACGGGG - Intergenic
982153150 4:152485778-152485800 AAACTGGTGCTATAAAAATGAGG + Intronic
982450260 4:155544245-155544267 AATATGTTGTTATGAAAAAGTGG - Intergenic
982478169 4:155877912-155877934 AAAATGTTGTAGAAAAAAACTGG + Intronic
983092867 4:163525707-163525729 AAAATGGAATTGAAAAAAAAAGG - Exonic
983337740 4:166418362-166418384 AAAAAGGTATTTCAAAAAAGTGG - Intergenic
983563164 4:169121850-169121872 AAACAGGAGTTGTACAAAAGAGG + Intronic
983890776 4:173027391-173027413 AAAATGGTCTTTTAAATAAATGG - Intronic
985397300 4:189557752-189557774 AAACAGGTGTTGTAGGAAAGGGG - Intergenic
986867282 5:12004587-12004609 GAAATGGTGTTTTTAAAAATGGG + Intergenic
987825884 5:23029909-23029931 AAAATGGTATTCTAGGAAAGAGG - Intergenic
987986913 5:25159182-25159204 AAAATGGTTGTTTAAACAAGAGG - Intergenic
988344984 5:30025486-30025508 AAAATGGTGTGGTAAAAAGTAGG + Intergenic
988958088 5:36339402-36339424 AAAATGGTGTTGTAACCCACAGG + Intergenic
989386584 5:40860574-40860596 AAAATGCTGTAGTAAAAATAAGG + Intergenic
989985445 5:50691484-50691506 AAAGTGGAGTTCTATAAAAGGGG - Intronic
990014725 5:51045921-51045943 AAAATGATATTGTAAAGCAGGGG + Intergenic
990471451 5:56120023-56120045 AAAATGGTGTTGAGAAAAGTTGG - Intronic
991239103 5:64436634-64436656 AAAATTATGTTGAAAAGAAGTGG - Intergenic
991655442 5:68899470-68899492 AAAATGGAGATGTGAAAATGAGG - Intergenic
992214369 5:74510878-74510900 AAAATGAGGTTTAAAAAAAGAGG + Intergenic
992416737 5:76559200-76559222 AAAAGGGAGTTGAAAAACAGAGG - Intronic
993019129 5:82570013-82570035 ACAAGGGTGTTATAGAAAAGTGG - Intergenic
993255312 5:85583462-85583484 TAAATGGTGTTGGGAAAAACTGG - Intergenic
993687629 5:90959708-90959730 CAAATGGTGCTGAAAAAAATTGG + Intronic
994006227 5:94840551-94840573 AAAATGGTGTTATATGAAAAGGG - Intronic
994546069 5:101167756-101167778 AAAATGGTGCTGGGAAAAAATGG + Intergenic
994995243 5:107053967-107053989 CAAATAGTGTTGGGAAAAAGTGG + Intergenic
995116717 5:108488865-108488887 AAAATGATGTTCAATAAAAGTGG - Intergenic
995146702 5:108795149-108795171 AAAATTTTTTTGTAAAGAAGGGG - Intronic
995237191 5:109842647-109842669 AAAAAGATGTTCTAAAAAAATGG - Intronic
995267099 5:110175033-110175055 GAAATGCTTTTGTAAAGAAGGGG + Intergenic
995628879 5:114111247-114111269 TAAATGGTGCTGGAAAAAACAGG + Intergenic
995982526 5:118121949-118121971 TAAATGGTGCTGTGAAAATGGGG - Intergenic
996586605 5:125095236-125095258 AAAATGCTGTTGGAAAAATTAGG - Intergenic
996664023 5:126036753-126036775 AAAATAGTGTTTTAAGAAATAGG + Intergenic
997539596 5:134650703-134650725 AAAATTATATTTTAAAAAAGAGG - Intronic
998343997 5:141444659-141444681 TAAATGGTATTGAAAAAAATGGG - Intronic
998501080 5:142633481-142633503 AAAATCTCCTTGTAAAAAAGAGG + Intronic
998641730 5:144019388-144019410 AAAAAGGTGTTGTCAAAGCGTGG - Intergenic
998896493 5:146805679-146805701 AAAATGGAGTGGTTTAAAAGTGG + Intronic
998932419 5:147195675-147195697 AGAATGGAATTTTAAAAAAGGGG + Intergenic
999864702 5:155687992-155688014 AAATTGGTGTGGGAAGAAAGAGG + Intergenic
999969377 5:156843975-156843997 AAAATGGTTATGTATAAAATGGG + Intergenic
1000353820 5:160374075-160374097 AAAATTGTGGTGAAAATAAGAGG + Intergenic
1000465219 5:161567549-161567571 ACAATGGTTTTTTAAATAAGGGG + Intronic
1001375973 5:171258650-171258672 AAAATGGTGCTGGAAAAATTGGG + Intronic
1002444639 5:179281976-179281998 AAAATGGTCTTATTAAAAATAGG - Intronic
1002553369 5:180015081-180015103 AAACTGCTGTTCTAATAAAGTGG - Intronic
1004680312 6:17887584-17887606 AAGATCGTGTTTTAAAAAACTGG - Intronic
1005170237 6:22975993-22976015 AAGATGGTTTTGTAAACAAATGG + Intergenic
1005923524 6:30420386-30420408 AAAATAATTTTTTAAAAAAGTGG + Intergenic
1006543453 6:34759281-34759303 AAAATGGTGTTCCATCAAAGAGG + Intronic
1006960278 6:37922746-37922768 GAAAAGGTGTGGTAAAAATGTGG + Intronic
1007889067 6:45269309-45269331 AAAATGGTGTTAAACAAATGAGG - Intronic
1007979697 6:46139039-46139061 AAAATATTGCTATAAAAAAGGGG - Intronic
1008134949 6:47763930-47763952 TAAAGAGTGTTGGAAAAAAGAGG - Intergenic
1008396233 6:51010623-51010645 TAAATGGTGTTGGGAAAAACTGG + Intergenic
1009747399 6:67835184-67835206 AAAATGATCTTGTAAACAATTGG - Intergenic
1009769879 6:68132137-68132159 AACATAGTGTTGTATAACAGTGG + Intergenic
1009944903 6:70331854-70331876 TAAATGGTGTTGGGAAAAACGGG - Intergenic
1010059651 6:71607905-71607927 AAACTGGTGCTTTAAAAAAATGG + Intergenic
1010339708 6:74734483-74734505 AAAATGTTTTTGTAAACAATTGG - Intergenic
1010401005 6:75445804-75445826 AAAAATGTGTTCAAAAAAAGAGG - Intronic
1010468367 6:76195792-76195814 CAAATGGTATTGGAAAAAACTGG - Intergenic
1010700888 6:79045411-79045433 CAAATGGTATTATAAAAAAATGG - Intronic
1010883799 6:81212870-81212892 AAAATATTGTTGAAGAAAAGTGG + Intergenic
1010967326 6:82226330-82226352 TAAATGGTGCTTTTAAAAAGAGG - Intronic
1011058463 6:83233623-83233645 GACATGGTGTTTTTAAAAAGTGG + Intronic
1011212850 6:84972622-84972644 AAAATTGTGTTATAAAAAGGGGG - Intergenic
1011421507 6:87178242-87178264 AAGCTGGTGTTCTTAAAAAGAGG + Intronic
1011752466 6:90467011-90467033 AAAAAGGGGTTTGAAAAAAGAGG - Intergenic
1013166738 6:107600905-107600927 ATAATGATCTTGTAAAAATGAGG - Intronic
1014208717 6:118685780-118685802 AAAATGGAGGTGGAAAAGAGAGG + Intronic
1014258835 6:119192689-119192711 CAAGTAGTGTTGTAAAATAGTGG - Intronic
1014395326 6:120921323-120921345 AAAATGCTTTTTTAAAAAAAGGG - Intergenic
1014605635 6:123470764-123470786 AAAATAATGTTGTAAAGAAAAGG + Intronic
1014638879 6:123883632-123883654 AAAATTTTTTTTTAAAAAAGAGG - Intronic
1014703434 6:124717164-124717186 AAAATGGGATTTTAAAAAATTGG + Intronic
1014946095 6:127499870-127499892 AATGTGGTGTTGTAAAAGAAAGG - Intronic
1014986167 6:128013131-128013153 AAAAGGGTGTTCCAAGAAAGAGG - Intronic
1015646561 6:135397395-135397417 AAAAGGGTGTTGTGAAAAGAGGG - Intronic
1016433419 6:144010872-144010894 TAAATGGTGTTGGGAAAAACTGG + Intronic
1016725287 6:147358139-147358161 AAAATGGCATTGAAGAAAAGTGG + Intronic
1017373553 6:153740608-153740630 AAAATGGTCTTTTAAAATATTGG - Intergenic
1017481336 6:154859480-154859502 AAAATGCTAGTGTAAAAAATTGG - Intronic
1018273268 6:162103108-162103130 AAAATGGTTTTAAAAAAAACAGG + Intronic
1018280955 6:162184880-162184902 AAACTCGTATTGTTAAAAAGTGG - Intronic
1018575906 6:165259761-165259783 CTGATGGTTTTGTAAAAAAGAGG + Intergenic
1019132967 6:169890838-169890860 AAAATGTTGATGGAAGAAAGGGG + Intergenic
1019531804 7:1506911-1506933 AAAAAGCTGTTTTCAAAAAGAGG - Intergenic
1019757798 7:2786331-2786353 AAAAGGGAGTTGGAAAAAACGGG + Intronic
1019871228 7:3764324-3764346 AAATATTTGTTGTAAAAAAGGGG - Intronic
1020429075 7:8101044-8101066 TAAAAGGTGTTGGAAAAAACTGG + Intergenic
1020907958 7:14088599-14088621 AAAATCATGTTTTAAAAAGGTGG + Intergenic
1021170337 7:17391751-17391773 AACCTGGTATTGTAATAAAGGGG - Intergenic
1021369732 7:19828723-19828745 AAAATGCTGTGGCAAAAATGTGG - Intergenic
1021422223 7:20458600-20458622 AAAATGATGTTGCAATAATGTGG - Intergenic
1021532775 7:21667452-21667474 AAAATGGTGTTTATAAAAACAGG + Intronic
1021533684 7:21678293-21678315 TTAATGGTGTTGGAAAAAACTGG - Intronic
1021866537 7:24963630-24963652 AGCATGGAGTGGTAAAAAAGGGG + Intronic
1022283460 7:28933415-28933437 AAAATGGAGTTTCAAAACAGGGG - Intergenic
1022881404 7:34591824-34591846 AAAATGATGATTTAGAAAAGTGG + Intergenic
1022926708 7:35062849-35062871 AGAACAATGTTGTAAAAAAGTGG + Intergenic
1022975863 7:35556503-35556525 AAAGTGATGTTGCAAAGAAGAGG + Intergenic
1024537330 7:50448936-50448958 AAAATGGTATAGTGAAAAAAAGG - Exonic
1024750454 7:52459194-52459216 AAAATGGAGTTGAAATTAAGGGG - Intergenic
1026076442 7:67174701-67174723 AAAATAGGATTATAAAAAAGCGG + Intronic
1027939332 7:84653659-84653681 CAAATGGTCTTGTTAAAAAGTGG - Intergenic
1028375561 7:90142702-90142724 AGAACAATGTTGTAAAAAAGTGG - Intergenic
1030717326 7:112824723-112824745 ACAATGGTGTTGAAACAAAGGGG - Intronic
1031124646 7:117759282-117759304 AAAATTGTTTTGTAAATATGAGG + Intronic
1031792744 7:126130426-126130448 AAAATGGTCTTATTAAAAATGGG + Intergenic
1032503949 7:132421812-132421834 AAATTGGTGTCTCAAAAAAGAGG - Intronic
1032807962 7:135376821-135376843 AAAATGATGTTTCAGAAAAGTGG - Intronic
1033320154 7:140332007-140332029 AAAATTTTTTTGTAGAAAAGGGG - Intronic
1036011391 8:4729197-4729219 AAAATGCTGTTTAAATAAAGAGG + Intronic
1036737748 8:11333079-11333101 AAAAAAGTGTTTTAAAAATGAGG + Intergenic
1037047292 8:14323351-14323373 GAAATTGTGTTATATAAAAGTGG - Intronic
1037284454 8:17283575-17283597 CAAATGGTGCTGGAAAAAACTGG - Intronic
1037302059 8:17462275-17462297 AAAATTGTATTTTAAAAATGTGG - Intergenic
1037414776 8:18638277-18638299 AAAACTGTGTTGAACAAAAGTGG - Intronic
1037927532 8:22855866-22855888 AAAATTTTTTTGTAAAAATGGGG - Intronic
1038609844 8:29050266-29050288 AAGATGGTGTTACAAATAAGGGG - Intronic
1038759299 8:30371878-30371900 AAAATGGGGCTGTAACCAAGAGG - Intergenic
1039362901 8:36899502-36899524 TAAATGGTGTTTTTAAAAGGAGG - Intronic
1040772636 8:50997061-50997083 TAAATGGTGCTGGAAAAAACTGG - Intergenic
1040928517 8:52710490-52710512 AATATGGTTTTATAAAAATGAGG + Intronic
1041907837 8:63053103-63053125 AAAATGACTTTTTAAAAAAGTGG + Intronic
1042156175 8:65846383-65846405 AAAGTGTTGGTGTACAAAAGTGG + Intergenic
1042500560 8:69504103-69504125 AACATGGCATTGTAGAAAAGTGG - Intronic
1043218750 8:77630935-77630957 AATATGGAGTTTTAAATAAGAGG + Intergenic
1043329074 8:79091138-79091160 AAACTGAGGTTGCAAAAAAGAGG + Intergenic
1043590653 8:81829852-81829874 AAAATTGTGTAGAACAAAAGTGG - Intronic
1044298688 8:90557889-90557911 CAAATGATGTTATAAATAAGAGG + Intergenic
1044766767 8:95584443-95584465 AAAATGGTGTTTTGACACAGTGG - Intergenic
1045069502 8:98486631-98486653 GAAATGGTGGAGGAAAAAAGGGG + Intronic
1045196535 8:99936957-99936979 CAAATGTAGTTGGAAAAAAGAGG - Intergenic
1045618590 8:103948003-103948025 ATAATAGTGCTGTCAAAAAGTGG + Intronic
1045749641 8:105467991-105468013 AGAATGGTGTTGAGAAAATGAGG - Intronic
1046159666 8:110343887-110343909 CAAATGGTGTGGGAAAAATGAGG + Intergenic
1046340397 8:112846580-112846602 AAAATTGTTTTGTAGAAAAAGGG + Intronic
1046751004 8:117926447-117926469 AAAATGGCTTTTTTAAAAAGTGG - Intronic
1047395413 8:124493485-124493507 AAAAGGGGGTAGGAAAAAAGGGG + Intronic
1048374962 8:133815215-133815237 ACTATGGTGTTGAAAGAAAGTGG + Intergenic
1049940208 9:538231-538253 AAGATCGTGTTGCAAAAAATGGG + Intronic
1049940465 9:541344-541366 TAAATGGTGTTGGAAAAACTGGG + Intronic
1050136278 9:2468890-2468912 AAAATTGTGATGTAATAAACTGG + Intergenic
1050661823 9:7891263-7891285 AAAATGGTAATATAAAACAGGGG + Intergenic
1050864177 9:10476903-10476925 TAAATGGTGCTGTAAAAACAAGG + Intronic
1050894995 9:10875566-10875588 AAAAGTGTTCTGTAAAAAAGGGG - Intergenic
1052524197 9:29592105-29592127 AAGATGGCTTTTTAAAAAAGAGG + Intergenic
1052863153 9:33449066-33449088 AAAAATCTGTTGTAAAAATGAGG + Intergenic
1054765770 9:69041286-69041308 AAAACAGTGTTGAACAAAAGGGG - Intronic
1054992430 9:71344507-71344529 AAAATGGATTTTTAAAAAACAGG + Intronic
1055165181 9:73183322-73183344 ATAAAGGTATTGTAAAAAACTGG + Intergenic
1056111478 9:83399942-83399964 AGTATGGTGTTGAAAAGAAGTGG - Intronic
1056252243 9:84761539-84761561 ATAATGGTTTTGTAACAAGGTGG - Intronic
1056340026 9:85620029-85620051 ATAATACTGTTATAAAAAAGAGG - Intronic
1057027889 9:91749207-91749229 AAAATGGTATGGTAATAAGGTGG + Intronic
1057104523 9:92399740-92399762 AAAATGGTCTTTTTAAAAAATGG - Intronic
1057542447 9:95988066-95988088 AAAATGGTTTCGTAGAAAAATGG - Intronic
1058125691 9:101191950-101191972 AAAATTGAGTTGTCAAAAATAGG - Intronic
1058131915 9:101263391-101263413 AATATGGTGATATAAAATAGAGG - Intronic
1058268266 9:102934635-102934657 AAAATAATGTTGTCAAATAGTGG - Intergenic
1058270318 9:102964913-102964935 AAAATCTTGTTTTAAAAATGAGG - Intergenic
1058571250 9:106347320-106347342 CAAATAGTATTGGAAAAAAGTGG + Intergenic
1058778862 9:108312925-108312947 TAATTGGTGCTGTAAAAAAGTGG + Intergenic
1058911639 9:109525228-109525250 AAAATGTTTTTGTAGAAATGGGG + Intergenic
1061471497 9:130830019-130830041 AAAATAGTCTTGTAAAAATCTGG - Intronic
1203620529 Un_KI270749v1:123838-123860 AAAATGGAGTTGTTAAGAGGTGG - Intergenic
1185835323 X:3340674-3340696 GAAATGGTGTTGTAATTTAGAGG + Intronic
1185971940 X:4674917-4674939 AAGATTATGTTATAAAAAAGGGG + Intergenic
1186167369 X:6840921-6840943 AAAATAGTCTTTTAAAAAAAAGG + Intergenic
1186309297 X:8300737-8300759 AAAATGGTTTAGTGAAAAAAGGG - Intergenic
1186940938 X:14506680-14506702 AAAAGGATGTTCTAATAAAGAGG + Intergenic
1186945750 X:14564706-14564728 AGAATGGTGTTGTATAAGAGTGG + Intronic
1186945753 X:14564767-14564789 AGAATGGTGTTGTATAAGAGTGG + Intronic
1187668766 X:21646909-21646931 TAAATGGAGTTGTAAAAACAAGG - Intronic
1187684492 X:21802975-21802997 AAAATGGTATTTTGGAAAAGAGG - Intergenic
1188048209 X:25452336-25452358 AGAATGGGGTTGAAAAAATGTGG + Intergenic
1188142376 X:26567703-26567725 AAAATAGTATTGTAAAAAAGGGG - Intergenic
1188383442 X:29527164-29527186 TAAATGGTTTCGTATAAAAGAGG + Intronic
1188681068 X:33005724-33005746 AATATGATGTTGAAAAAGAGTGG - Intronic
1188874923 X:35417870-35417892 AACATGATTTTGTGAAAAAGAGG + Intergenic
1189879410 X:45473398-45473420 ATAATAGTATTGCAAAAAAGAGG - Intergenic
1190192531 X:48289536-48289558 AGAAAGGTGTTGTTGAAAAGAGG + Intergenic
1191749128 X:64522132-64522154 TAAAAGGTATTGAAAAAAAGGGG - Intergenic
1192397647 X:70798757-70798779 TAAATGGTGTTGGAAAAACCTGG + Intronic
1192742661 X:73908413-73908435 TAAATGGTGTTGGAAAAACTGGG - Intergenic
1193413465 X:81194047-81194069 AAGATGGTATTGCAAAATAGTGG + Intronic
1193663761 X:84289693-84289715 TAAATGGTGCTGGAAAAAACTGG - Intergenic
1193687985 X:84602279-84602301 TAAATGGTGGTGAAAAAAACTGG - Intergenic
1194232612 X:91342715-91342737 AAAGTGTTGCTGAAAAAAAGGGG - Intergenic
1194603508 X:95953207-95953229 AAAATGGTTTAGTTAAAAATAGG + Intergenic
1194712965 X:97257983-97258005 AAAATGAAATTGGAAAAAAGAGG - Intronic
1194757738 X:97757751-97757773 AAAATATTTTTGTAAAAAACGGG - Intergenic
1194810300 X:98380492-98380514 AAAATGTTGTAGAAAAAAACTGG + Intergenic
1195540761 X:106060035-106060057 AAAATGGCCTTTTAAAAAATTGG + Intergenic
1195850509 X:109277334-109277356 ACAATGGTAGAGTAAAAAAGTGG - Intergenic
1196281926 X:113832201-113832223 AAAATGCTTTTCTATAAAAGTGG + Intergenic
1196333843 X:114506434-114506456 AAAATGGTGTTTTCAACAAGTGG + Intergenic
1197119948 X:122879246-122879268 TATATTGTTTTGTAAAAAAGTGG + Intergenic
1197139991 X:123107139-123107161 AATATGATGTGGGAAAAAAGGGG - Intergenic
1197317930 X:124991604-124991626 CAAATGATGATGCAAAAAAGGGG + Intergenic
1197944199 X:131820647-131820669 AAAAATGTTTTTTAAAAAAGAGG + Intergenic
1198538523 X:137611152-137611174 AAAATACTCTTGAAAAAAAGTGG + Intergenic
1199535858 X:148902464-148902486 AAAAGGGTTTTTTAAAAAAAAGG + Intronic
1200617487 Y:5397177-5397199 AAAATAGTGTTGAAATAAAGAGG - Intronic
1200760085 Y:7029573-7029595 AAAATGATTTTTTAAAGAAGGGG + Intronic
1201241350 Y:11959645-11959667 GAAATGGTGTTGTAATTTAGAGG - Intergenic
1201380521 Y:13372353-13372375 AAAATAGTGTTCTAAACAAATGG + Intronic
1202350799 Y:23988829-23988851 AAAATGGAGGTTAAAAAAAGTGG - Intergenic
1202519980 Y:25681290-25681312 AAAATGGAGGTTAAAAAAAGTGG + Intergenic