ID: 941420817

View in Genome Browser
Species Human (GRCh38)
Location 2:165281249-165281271
Sequence GTTATAGAGGGAAATAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941420809_941420817 20 Left 941420809 2:165281206-165281228 CCCTATCTCTAAAAAAATAGATA No data
Right 941420817 2:165281249-165281271 GTTATAGAGGGAAATAAGGAAGG No data
941420810_941420817 19 Left 941420810 2:165281207-165281229 CCTATCTCTAAAAAAATAGATAT No data
Right 941420817 2:165281249-165281271 GTTATAGAGGGAAATAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941420817 Original CRISPR GTTATAGAGGGAAATAAGGA AGG Intronic
No off target data available for this crispr