ID: 941422274

View in Genome Browser
Species Human (GRCh38)
Location 2:165297403-165297425
Sequence ATGGTCAAAATTAATGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941422274_941422280 22 Left 941422274 2:165297403-165297425 CCTTTCTCATTAATTTTGACCAT No data
Right 941422280 2:165297448-165297470 AGTCTTCAATTTACAATGTTAGG No data
941422274_941422282 28 Left 941422274 2:165297403-165297425 CCTTTCTCATTAATTTTGACCAT No data
Right 941422282 2:165297454-165297476 CAATTTACAATGTTAGGTAAGGG No data
941422274_941422281 27 Left 941422274 2:165297403-165297425 CCTTTCTCATTAATTTTGACCAT No data
Right 941422281 2:165297453-165297475 TCAATTTACAATGTTAGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941422274 Original CRISPR ATGGTCAAAATTAATGAGAA AGG (reversed) Intronic
No off target data available for this crispr