ID: 941424811

View in Genome Browser
Species Human (GRCh38)
Location 2:165329294-165329316
Sequence GGTCACACCTTTGTGAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941424808_941424811 29 Left 941424808 2:165329242-165329264 CCATTTGCGTTTCAAATTTTTAA No data
Right 941424811 2:165329294-165329316 GGTCACACCTTTGTGAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941424811 Original CRISPR GGTCACACCTTTGTGAAGGA TGG Intronic
No off target data available for this crispr