ID: 941425316

View in Genome Browser
Species Human (GRCh38)
Location 2:165337516-165337538
Sequence GACTAAGATGTGCCTAAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941425316_941425318 22 Left 941425316 2:165337516-165337538 CCATACTTAGGCACATCTTAGTC No data
Right 941425318 2:165337561-165337583 CAAAAAGCTTTGGAAACAACCGG No data
941425316_941425317 12 Left 941425316 2:165337516-165337538 CCATACTTAGGCACATCTTAGTC No data
Right 941425317 2:165337551-165337573 ACAACAATAACAAAAAGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941425316 Original CRISPR GACTAAGATGTGCCTAAGTA TGG (reversed) Intronic
No off target data available for this crispr