ID: 941425435

View in Genome Browser
Species Human (GRCh38)
Location 2:165338929-165338951
Sequence TCCACGCCCGGCTAGATGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941425435_941425440 10 Left 941425435 2:165338929-165338951 CCCTACATCTAGCCGGGCGTGGA No data
Right 941425440 2:165338962-165338984 TGTAATCCCAGCACTTTGTGAGG 0: 2119
1: 302734
2: 268149
3: 150508
4: 132167
941425435_941425444 22 Left 941425435 2:165338929-165338951 CCCTACATCTAGCCGGGCGTGGA No data
Right 941425444 2:165338974-165338996 ACTTTGTGAGGCTGAGGCAGTGG No data
941425435_941425442 16 Left 941425435 2:165338929-165338951 CCCTACATCTAGCCGGGCGTGGA No data
Right 941425442 2:165338968-165338990 CCCAGCACTTTGTGAGGCTGAGG 0: 563
1: 89236
2: 212635
3: 238365
4: 264805

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941425435 Original CRISPR TCCACGCCCGGCTAGATGTA GGG (reversed) Intronic
No off target data available for this crispr