ID: 941425440

View in Genome Browser
Species Human (GRCh38)
Location 2:165338962-165338984
Sequence TGTAATCCCAGCACTTTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 855677
Summary {0: 2119, 1: 302734, 2: 268149, 3: 150508, 4: 132167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941425438_941425440 -2 Left 941425438 2:165338941-165338963 CCGGGCGTGGAGGCTCACGCCTG 0: 33
1: 8480
2: 58080
3: 125339
4: 194067
Right 941425440 2:165338962-165338984 TGTAATCCCAGCACTTTGTGAGG 0: 2119
1: 302734
2: 268149
3: 150508
4: 132167
941425436_941425440 9 Left 941425436 2:165338930-165338952 CCTACATCTAGCCGGGCGTGGAG No data
Right 941425440 2:165338962-165338984 TGTAATCCCAGCACTTTGTGAGG 0: 2119
1: 302734
2: 268149
3: 150508
4: 132167
941425435_941425440 10 Left 941425435 2:165338929-165338951 CCCTACATCTAGCCGGGCGTGGA No data
Right 941425440 2:165338962-165338984 TGTAATCCCAGCACTTTGTGAGG 0: 2119
1: 302734
2: 268149
3: 150508
4: 132167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941425440 Original CRISPR TGTAATCCCAGCACTTTGTG AGG Intronic
Too many off-targets to display for this crispr