ID: 941425442

View in Genome Browser
Species Human (GRCh38)
Location 2:165338968-165338990
Sequence CCCAGCACTTTGTGAGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 805604
Summary {0: 563, 1: 89236, 2: 212635, 3: 238365, 4: 264805}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941425436_941425442 15 Left 941425436 2:165338930-165338952 CCTACATCTAGCCGGGCGTGGAG No data
Right 941425442 2:165338968-165338990 CCCAGCACTTTGTGAGGCTGAGG 0: 563
1: 89236
2: 212635
3: 238365
4: 264805
941425435_941425442 16 Left 941425435 2:165338929-165338951 CCCTACATCTAGCCGGGCGTGGA No data
Right 941425442 2:165338968-165338990 CCCAGCACTTTGTGAGGCTGAGG 0: 563
1: 89236
2: 212635
3: 238365
4: 264805
941425438_941425442 4 Left 941425438 2:165338941-165338963 CCGGGCGTGGAGGCTCACGCCTG 0: 33
1: 8480
2: 58080
3: 125339
4: 194067
Right 941425442 2:165338968-165338990 CCCAGCACTTTGTGAGGCTGAGG 0: 563
1: 89236
2: 212635
3: 238365
4: 264805

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941425442 Original CRISPR CCCAGCACTTTGTGAGGCTG AGG Intronic
Too many off-targets to display for this crispr