ID: 941425444

View in Genome Browser
Species Human (GRCh38)
Location 2:165338974-165338996
Sequence ACTTTGTGAGGCTGAGGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941425439_941425444 -9 Left 941425439 2:165338960-165338982 CCTGTAATCCCAGCACTTTGTGA 0: 1786
1: 298626
2: 265319
3: 148850
4: 129231
Right 941425444 2:165338974-165338996 ACTTTGTGAGGCTGAGGCAGTGG No data
941425438_941425444 10 Left 941425438 2:165338941-165338963 CCGGGCGTGGAGGCTCACGCCTG 0: 33
1: 8480
2: 58080
3: 125339
4: 194067
Right 941425444 2:165338974-165338996 ACTTTGTGAGGCTGAGGCAGTGG No data
941425436_941425444 21 Left 941425436 2:165338930-165338952 CCTACATCTAGCCGGGCGTGGAG No data
Right 941425444 2:165338974-165338996 ACTTTGTGAGGCTGAGGCAGTGG No data
941425435_941425444 22 Left 941425435 2:165338929-165338951 CCCTACATCTAGCCGGGCGTGGA No data
Right 941425444 2:165338974-165338996 ACTTTGTGAGGCTGAGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941425444 Original CRISPR ACTTTGTGAGGCTGAGGCAG TGG Intronic
No off target data available for this crispr