ID: 941435747

View in Genome Browser
Species Human (GRCh38)
Location 2:165469247-165469269
Sequence TTTGATATGCAGACAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 316}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941435747_941435751 -7 Left 941435747 2:165469247-165469269 CCCTCCTCTGTCTGCATATCAAA 0: 1
1: 0
2: 1
3: 34
4: 316
Right 941435751 2:165469263-165469285 TATCAAAATGTATAATGAGGAGG 0: 1
1: 0
2: 0
3: 33
4: 233
941435747_941435750 -10 Left 941435747 2:165469247-165469269 CCCTCCTCTGTCTGCATATCAAA 0: 1
1: 0
2: 1
3: 34
4: 316
Right 941435750 2:165469260-165469282 GCATATCAAAATGTATAATGAGG 0: 1
1: 0
2: 1
3: 21
4: 255
941435747_941435753 24 Left 941435747 2:165469247-165469269 CCCTCCTCTGTCTGCATATCAAA 0: 1
1: 0
2: 1
3: 34
4: 316
Right 941435753 2:165469294-165469316 TTTCACTGAGAAAAATCAGTGGG 0: 1
1: 0
2: 4
3: 43
4: 374
941435747_941435752 23 Left 941435747 2:165469247-165469269 CCCTCCTCTGTCTGCATATCAAA 0: 1
1: 0
2: 1
3: 34
4: 316
Right 941435752 2:165469293-165469315 TTTTCACTGAGAAAAATCAGTGG 0: 1
1: 0
2: 0
3: 48
4: 431

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941435747 Original CRISPR TTTGATATGCAGACAGAGGA GGG (reversed) Intergenic
900482072 1:2904267-2904289 GTGGAGATGCAGACAGAGGCAGG + Intergenic
902602305 1:17548482-17548504 TTTGTTATGCAGATAAAGTAAGG + Intronic
902965363 1:19997060-19997082 TTTGATAAGCTGACAGAAGTAGG + Intergenic
906226398 1:44125926-44125948 TATGAGGTGCAGACAGAGGTTGG - Intronic
906535058 1:46546907-46546929 TTTGATAGGCAGACAGAAGCAGG + Intronic
907509489 1:54947580-54947602 ATTGAGATGCAGAGAGGGGAAGG + Intergenic
908142045 1:61195489-61195511 GATAATATACAGACAGAGGAGGG - Intronic
908230919 1:62104114-62104136 TTACATATGCAGAGATAGGAAGG + Intronic
909838760 1:80290899-80290921 TTTCATGTGCACACAGTGGAAGG + Intergenic
909970621 1:81982600-81982622 TTAGATATGTAGGCAGAGAAAGG - Intronic
910349592 1:86280579-86280601 TATGATCAGCTGACAGAGGAAGG + Intergenic
910589666 1:88917202-88917224 TTAGATATCCAGATATAGGAGGG - Intergenic
911128892 1:94369261-94369283 TTTGACAAGCTGACAGAAGAAGG - Intergenic
911401157 1:97377452-97377474 TTTCATATCAAGGCAGAGGAAGG - Intronic
913098299 1:115540349-115540371 TCTGTACTGCAGACAGAGGATGG - Intergenic
913434268 1:118830926-118830948 TTTGAGATGCACACTGAAGAAGG + Intergenic
913572424 1:120134038-120134060 TTTGAGATTCAGACAGGGGAAGG - Intergenic
915641091 1:157227124-157227146 TTTTATATGTAGACATATGATGG + Intergenic
915644154 1:157255082-157255104 TTTGACAAGTTGACAGAGGAAGG + Intergenic
915906367 1:159880770-159880792 AGAGAGATGCAGACAGAGGAGGG + Intronic
916122330 1:161539683-161539705 TTAGACATGCAGACAGAACACGG - Intergenic
918623033 1:186626614-186626636 TTTGACATGGCTACAGAGGAAGG - Intergenic
919675647 1:200380078-200380100 TTTTATATGTAGAGAGAGAAAGG + Intergenic
920996489 1:210997169-210997191 TTTGATTAGCTGACAGAAGAAGG + Intronic
921315431 1:213886008-213886030 TCAGAGATGCAGAGAGAGGAAGG - Intergenic
922041633 1:221903524-221903546 TGAGGTACGCAGACAGAGGAGGG + Intergenic
922056540 1:222047577-222047599 TTTCATATGAGGACAAAGGAAGG + Intergenic
922092771 1:222413067-222413089 TTTGATAGGCAGAGATAGAAAGG - Intergenic
922582559 1:226709644-226709666 TTTCATATTTAGACAAAGGAAGG - Intronic
922646347 1:227290632-227290654 TTTTATAGGCATTCAGAGGAGGG + Intronic
922813394 1:228431478-228431500 ATTGATGTGCGGAGAGAGGATGG - Intergenic
923058120 1:230444120-230444142 CTTGATATGAAGCCATAGGATGG + Intergenic
924082712 1:240416037-240416059 TTTCACATACAGAAAGAGGAAGG - Intronic
924563860 1:245179827-245179849 TTTGCTTTGGAGACAGAGGGTGG + Intronic
1063352048 10:5365031-5365053 TTTTATATACACACAGGGGAGGG + Exonic
1066665949 10:37782692-37782714 TTTGATATGGAGGCAGAGATTGG + Intronic
1068994974 10:63192110-63192132 TTTGATATGTAGTCAAAGGAAGG + Intronic
1069440933 10:68427415-68427437 TTTGGGAGGCAGACAGAGGTGGG + Intronic
1069528407 10:69195221-69195243 TTAGAGATCCAGCCAGAGGATGG + Exonic
1070349404 10:75577037-75577059 TTTGATGAGCTGACAGAAGAAGG + Intronic
1071349766 10:84728278-84728300 TTTGATAAGCTGACAGAAGTAGG + Intergenic
1071803980 10:89096404-89096426 TGTAATATGTAGACAGAGGGGGG + Intergenic
1072818799 10:98536032-98536054 TCTTATATGCAGACAAAAGATGG + Intronic
1073333463 10:102686752-102686774 TTTGATAATCAGACTGAGCACGG - Intronic
1073442361 10:103559629-103559651 GCTGAGATGCAGACAGATGAAGG - Intronic
1073479285 10:103776075-103776097 TATGATTTGAAGACAGAGAAAGG - Intronic
1075551219 10:123394149-123394171 TGGGCTATGCAGACAGAGAAAGG + Intergenic
1076587242 10:131557959-131557981 TTAGCTATGCAGTCAGGGGAAGG + Intergenic
1077329613 11:1978277-1978299 CTTGAGGTGCAGAGAGAGGATGG + Intronic
1078092648 11:8276856-8276878 GTGGACATGCAGAGAGAGGATGG - Intergenic
1078831256 11:14979549-14979571 TTGGGTTTGAAGACAGAGGAAGG - Intronic
1081456636 11:43229700-43229722 TTTGATTCTCAAACAGAGGAGGG - Intergenic
1082091228 11:48091212-48091234 ATTGAGATGCAAACATAGGAAGG - Intronic
1082136805 11:48558566-48558588 TTTGATGAGCTGACAGAAGAGGG - Intergenic
1082232075 11:49780108-49780130 TTTGATGAGCTGAGAGAGGAAGG - Intergenic
1082614176 11:55338464-55338486 TTTGATGAGCTGACAGAAGAGGG - Intergenic
1082881699 11:58044414-58044436 TTTTCGTTGCAGACAGAGGAAGG + Intronic
1084177082 11:67428564-67428586 TTGGATTTGGAGACGGAGGAAGG + Exonic
1084927321 11:72523850-72523872 TATGATGTGCAGTCAAAGGAGGG - Intergenic
1086653188 11:89318240-89318262 TTTGATGAGCTGAGAGAGGAAGG - Intergenic
1087318360 11:96631221-96631243 TTTGAAATGCAAACATGGGAGGG + Intergenic
1088503821 11:110510061-110510083 TTTGAGATGCAAAGAGAAGATGG - Intergenic
1090826488 11:130390724-130390746 GTGGATATGCAGGCAGGGGAAGG + Intergenic
1202812592 11_KI270721v1_random:33456-33478 CTTGAGGTGCAGAGAGAGGATGG + Intergenic
1092141145 12:6184330-6184352 GTGGCTTTGCAGACAGAGGAGGG - Intergenic
1092707342 12:11298676-11298698 TTTGATGAGCTGAGAGAGGAAGG + Intergenic
1093790660 12:23245652-23245674 TTTCACATGCTCACAGAGGAAGG + Intergenic
1096796432 12:54080822-54080844 TTTGAGGTGGAGACAGAAGAAGG - Intergenic
1097401935 12:59138515-59138537 TTGGTTATGCCGACATAGGAGGG + Intergenic
1097696251 12:62777549-62777571 TATCATATGCAAACCGAGGATGG + Intronic
1098609925 12:72444025-72444047 CTTTATATGCAAAAAGAGGAAGG - Intronic
1099240659 12:80134843-80134865 TCTGATATGCAGAGATATGAGGG - Intergenic
1099298625 12:80863141-80863163 TTTGATAGAAAGAAAGAGGAAGG + Intronic
1101077077 12:101141590-101141612 TCTGAGAAGTAGACAGAGGATGG + Intergenic
1102831547 12:116006401-116006423 TTTATTATACAGTCAGAGGATGG - Exonic
1104054699 12:125220551-125220573 TTGGAAATGCCGACAGAGAAGGG - Intronic
1104333213 12:127866875-127866897 TTTGATAAGCTGAGAGAAGAAGG + Intergenic
1105211708 13:18260986-18261008 TTTGTTAGGCAGAGAGAGGAAGG - Intergenic
1105265322 13:18809839-18809861 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1105718859 13:23094192-23094214 TTATATCTGGAGACAGAGGAGGG + Intergenic
1105797807 13:23873656-23873678 TTTGGGATGCAGACAGATGCAGG + Intronic
1106669301 13:31887987-31888009 TTTGCTATGCTGACAGAGGCAGG - Intergenic
1107047833 13:36013212-36013234 TTTGATGAGCTGAGAGAGGAAGG - Intronic
1108714136 13:53062013-53062035 TTTGATAGGCAGAGCAAGGAAGG - Intergenic
1108761396 13:53570165-53570187 ATGGATATGCAGAAAGGGGAAGG - Intergenic
1108912734 13:55577144-55577166 TGTGATATGCAGAAAGGGGAAGG - Intergenic
1109759269 13:66805711-66805733 CTTGATATGAGGACATAGGACGG - Intronic
1110032764 13:70637919-70637941 TTTAATATGCACAGAGAGTAAGG + Intergenic
1113554065 13:111216894-111216916 TCTGAAAGGCAGAAAGAGGAAGG - Intronic
1113567997 13:111330527-111330549 TTTTATCTGTAGTCAGAGGAAGG - Intronic
1115008510 14:28515859-28515881 TTTGATATGCAGAATTAGGAAGG + Intergenic
1115126431 14:30000101-30000123 TTTGATATATACATAGAGGATGG + Intronic
1115434375 14:33356395-33356417 TTCTAAATGCAGACAGAGGGAGG - Intronic
1115476083 14:33814155-33814177 TTGGATATGGAGAGAGATGATGG + Intergenic
1115500053 14:34041691-34041713 ATGGATATGGTGACAGAGGAAGG + Intronic
1116233673 14:42250412-42250434 TTTGATATGGAGACAGAAAATGG - Intergenic
1117527526 14:56624731-56624753 CTGGCTATGGAGACAGAGGAGGG + Intronic
1118037149 14:61880060-61880082 TTTCATCTGCAGACAGAGGTGGG - Intergenic
1119158147 14:72430457-72430479 TCTCTTCTGCAGACAGAGGAGGG + Intronic
1119177702 14:72581313-72581335 TTGGATATGGAGGCAGATGAGGG - Intergenic
1119755154 14:77112396-77112418 TTTTAGAGTCAGACAGAGGATGG + Intronic
1120197614 14:81502740-81502762 TTTGAGAAGCTGACTGAGGAAGG - Exonic
1120445392 14:84588543-84588565 TTTCAAATACAGCCAGAGGAGGG + Intergenic
1120829963 14:88989257-88989279 CTTGATATCCAGAGAGAGAAGGG + Intergenic
1202833170 14_GL000009v2_random:58277-58299 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1123428306 15:20191433-20191455 TTTGCAAAGAAGACAGAGGAAGG - Intergenic
1124257769 15:28159716-28159738 TTTGATGAGCTGAGAGAGGAAGG - Intronic
1126256914 15:46638512-46638534 TTTGACAGGAAGACAGAGGAGGG + Intergenic
1127079142 15:55358563-55358585 TTTGCTATGCAGACAGGGAAGGG - Intronic
1130995867 15:88903784-88903806 TTAGAAATGCAGACTGAGGCCGG - Intronic
1131029691 15:89176133-89176155 TATGATATGCAGACAAAACAAGG - Intronic
1131270266 15:90942950-90942972 TTAGATCTGCTGACAGAGGTGGG + Exonic
1132218418 15:100085000-100085022 TTTGATGAGCTGACAGAAGAAGG + Intronic
1135709171 16:24700531-24700553 TTTAATATTCAGACATAGGCTGG - Intergenic
1136032431 16:27513540-27513562 TTAGATCTGAAGACAGAGGAAGG + Intronic
1136246175 16:28977539-28977561 ATTGGGATGCAGACAGAGGAAGG + Intronic
1136856012 16:33658318-33658340 TTTGCAAAGAAGACAGAGGAAGG + Intergenic
1136926448 16:34379737-34379759 TTTGATAAGTAGAAGGAGGAGGG - Intergenic
1136978126 16:35032070-35032092 TTTGATAAGTAGAAGGAGGAGGG + Intergenic
1138801844 16:60041519-60041541 TTTGGTGTGCAGACTGAGAACGG - Intergenic
1139121333 16:64022250-64022272 TTTGCAATACAGACAGAAGAGGG - Intergenic
1140682035 16:77394568-77394590 CTTAATATACAGAAAGAGGAGGG + Intronic
1141759954 16:86021691-86021713 TTTGAGAGGCCGACAGAGGCAGG - Intergenic
1141765163 16:86053287-86053309 GTTGATATGCAGTCAGAGGGTGG - Intergenic
1141794418 16:86260624-86260646 ATTGATATCCAGAAAAAGGATGG - Intergenic
1203117598 16_KI270728v1_random:1506797-1506819 TTTGCAAAGAAGACAGAGGAAGG + Intergenic
1143953568 17:10652361-10652383 TTAGATATGCGGGCAGGGGAGGG - Intronic
1146217072 17:30985812-30985834 TTTGAGAGGCAGACAGAGATGGG - Intronic
1146584405 17:34069802-34069824 AATGATATGAAGACAGAGGGAGG + Intronic
1146649638 17:34598636-34598658 TTTGATGTGCAGAAGGTGGAAGG + Intronic
1148786117 17:50147105-50147127 TTTGATAGGCTGAGAGAAGAGGG - Intronic
1149020235 17:51955195-51955217 TTCGAGATGCAGAAAGATGAAGG - Intronic
1149066559 17:52487727-52487749 TTTGACATGTAGACAAAGGATGG + Intergenic
1149282600 17:55124883-55124905 TTGTACATGCACACAGAGGAGGG + Intronic
1149631945 17:58133291-58133313 TGTGTTAGGCAGACAAAGGAGGG - Intergenic
1150796787 17:68245104-68245126 TTTGAAATGCAGACAGACTATGG + Intergenic
1152154171 17:78622160-78622182 TGTGAAATGCAGGGAGAGGAGGG - Intergenic
1154423073 18:14251690-14251712 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1155327157 18:24675980-24676002 TTTTACAGGCAGACAGAGGTAGG + Intergenic
1157127813 18:44973788-44973810 GTGGAGAGGCAGACAGAGGAGGG + Intronic
1157674536 18:49559497-49559519 TTTAATGTGGAGACACAGGAGGG + Intergenic
1157694536 18:49710398-49710420 TTCCAAATGCAGAGAGAGGAGGG - Intergenic
1158144623 18:54298325-54298347 CCTGATGTCCAGACAGAGGAGGG - Intronic
1158366654 18:56744494-56744516 TTTGAAATGCAGACATAAAAGGG + Intronic
1159334938 18:67049926-67049948 ATTTATATGCAGACTGAAGAGGG - Intergenic
1160896828 19:1407083-1407105 TGTGAAATGCGGACAGGGGAAGG + Intergenic
1162248413 19:9422507-9422529 TTTGGTATGCAGACAGGCCATGG - Intronic
1162888301 19:13712944-13712966 TTTGAGAAGCTGAAAGAGGAGGG + Intergenic
1164773769 19:30834488-30834510 TGTCATATGAAGACAGAGGATGG + Intergenic
1165253728 19:34559967-34559989 TTTAATAGACAGACAAAGGAAGG + Intergenic
1167767416 19:51492690-51492712 CTTGACTTGCAGACAGAGGGAGG + Intronic
1202639497 1_KI270706v1_random:69433-69455 CTGGGGATGCAGACAGAGGAGGG + Intergenic
925197263 2:1936217-1936239 TTTAAGATGCAGGTAGAGGACGG - Intronic
926581615 2:14635750-14635772 TTTGAAATGCAGCCCGAGGAGGG - Exonic
928948115 2:36790291-36790313 GTAGAGATGCAGGCAGAGGAGGG - Intronic
930690767 2:54361767-54361789 TTTGGTATGAAGACAGGGAAGGG + Intronic
931235975 2:60412973-60412995 TTTTAAAAGCAGACAGAGGTAGG + Intergenic
932090138 2:68799172-68799194 TTTGATATGCAGAGAGAATGTGG + Intronic
932122065 2:69110918-69110940 ATTTATATGCAGACAGAGACTGG + Intronic
932227083 2:70050323-70050345 TTTGATATGAAGAGAGTGGTTGG - Intergenic
932591245 2:73069205-73069227 TCTGACTTGCAGAAAGAGGAAGG + Intronic
933327060 2:80851448-80851470 TATGAAATGAAGACAGAAGAGGG - Intergenic
934301917 2:91781469-91781491 TTCGTTAGGCAGAGAGAGGAAGG + Intergenic
934494982 2:94788883-94788905 CTGGGGATGCAGACAGAGGAGGG + Intergenic
935701620 2:105817200-105817222 AATGAGATGCAGACAGATGAAGG + Intronic
937880968 2:126864352-126864374 TTTGGTATCTAGAAAGAGGATGG - Intergenic
938962924 2:136359182-136359204 CTTGCTCTGCAGACAGAGGTGGG + Intergenic
939701978 2:145403334-145403356 TTTGAATTACTGACAGAGGAAGG - Intergenic
940154754 2:150643714-150643736 TTTGATGACAAGACAGAGGAAGG - Intergenic
940385055 2:153061084-153061106 ATTTATATGCATACAGATGAAGG - Intergenic
940645039 2:156382736-156382758 TTTGATATTCTGAAATAGGAAGG - Intergenic
940903137 2:159145165-159145187 TTTGGTAAGCAGAAAAAGGAAGG + Intronic
941435747 2:165469247-165469269 TTTGATATGCAGACAGAGGAGGG - Intergenic
941796048 2:169599697-169599719 TTTGATAGACAGACAGTGAAAGG + Intronic
943022501 2:182592067-182592089 TTTGATTTGAAGTCAGAGGATGG - Intergenic
944943929 2:204661193-204661215 TTTGAGATGGGGAAAGAGGAAGG - Intronic
945805660 2:214487081-214487103 TTCCATGTGAAGACAGAGGAAGG + Intronic
947330532 2:229025113-229025135 GCTGATTTGCATACAGAGGAGGG + Exonic
947425860 2:229982327-229982349 TTGGCTTTGCAGATAGAGGAAGG - Intronic
947796351 2:232896466-232896488 TTTGTTATGGCCACAGAGGAGGG + Intronic
948087576 2:235264404-235264426 TTTGCTTTGAAGAAAGAGGAAGG + Intergenic
948310945 2:236986334-236986356 AATGATATGGAGACAGATGAAGG + Intergenic
1170723923 20:18908794-18908816 CTTTCTATCCAGACAGAGGAAGG - Intergenic
1171277640 20:23871687-23871709 TTTAAAATGCAGACATAGGGAGG + Intergenic
1171885971 20:30652659-30652681 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1171886165 20:30653789-30653811 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1172119027 20:32586774-32586796 TGTGAAATGCAGAGAGAGGTTGG - Intronic
1173093976 20:40006468-40006490 TTGGATATGTAGACAGATGATGG + Intergenic
1173437184 20:43043918-43043940 TGGGATAAGCAGACAGAGGAAGG - Intronic
1173578561 20:44129867-44129889 TGTGTTTTGAAGACAGAGGAAGG + Intronic
1174207424 20:48850820-48850842 TTTGCCAGGCAGACAGAGGAAGG - Intergenic
1174765207 20:53247103-53247125 TCTGACTTTCAGACAGAGGAGGG + Intronic
1174853810 20:54023571-54023593 TTTGATAAACAGAGAGAGAAAGG + Intronic
1174865316 20:54130230-54130252 TTAGAAATGCAGAGGGAGGATGG + Intergenic
1176647827 21:9367032-9367054 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1176850387 21:13908258-13908280 GTGGGGATGCAGACAGAGGAGGG + Intergenic
1177470011 21:21548439-21548461 TTTGTTATGTAGACAGTGGAGGG - Intergenic
1180362445 22:11912437-11912459 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1180785130 22:18542912-18542934 TTAGAAATGCAGAGAGAGGCCGG + Intergenic
1180814513 22:18781250-18781272 TTCGTTAGGCAGAGAGAGGAAGG - Intergenic
1181128712 22:20716947-20716969 TTAGAAATGCAGAGAGAGGCCGG + Intronic
1181200701 22:21215586-21215608 TTCGTTAGGCAGAGAGAGGAAGG - Intronic
1181242033 22:21482266-21482288 TTAGAAATGCAGAGAGAGGCCGG + Intergenic
1181701040 22:24621387-24621409 TTTGTTAGGCAGAGAGAGGAAGG + Intronic
1182102216 22:27665936-27665958 TGTGATATGCCCACAGAGAAGGG + Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1184377403 22:44123372-44123394 TTTGAGAGGGAGAGAGAGGAAGG + Intronic
1184800941 22:46758885-46758907 TCTGCTTTCCAGACAGAGGAAGG + Intergenic
1203226216 22_KI270731v1_random:79849-79871 TTCGTTAGGCAGAGAGAGGAAGG + Intergenic
1203264612 22_KI270734v1_random:6937-6959 TTCGTTAGGCAGAGAGAGGAAGG - Intergenic
949415911 3:3814005-3814027 CTAGATGTGCAGACAGGGGAGGG - Intronic
949476154 3:4447850-4447872 TTAGGTATGAAGACAGAGGTGGG - Intronic
949970827 3:9402469-9402491 TTTGATATGAAGACAGGGAAAGG + Intronic
950399325 3:12758627-12758649 TTTGAGCTGGAGGCAGAGGACGG + Intronic
952154910 3:30632209-30632231 TTTGACATGCAGAGATGGGAAGG - Intronic
954975996 3:54695409-54695431 TGTGATATGCACAAAGATGATGG - Intronic
955971387 3:64442025-64442047 TTTGAAGTCCAGACAGAGCAGGG - Intronic
958697578 3:97547049-97547071 TTTGATGAGCTGACAGAAGAAGG - Intronic
958758094 3:98274425-98274447 ATTCATAGGCAGACAGGGGAAGG + Intergenic
960644206 3:119860508-119860530 TTCCATATTCAGATAGAGGAAGG - Intronic
961612960 3:128155072-128155094 TTTCATTTGCAGAGATAGGAGGG - Intronic
961993907 3:131220749-131220771 TTAGATATGCAGAGAGAGGCAGG + Intronic
962533600 3:136306047-136306069 TTTGCTATACTGACAGAAGAGGG + Intronic
966267818 3:178067700-178067722 TTTCATATGCAGGCAGAAAATGG + Intergenic
967000567 3:185330276-185330298 TCTGAGATGAAGACAGAGGAAGG - Intronic
967703659 3:192623574-192623596 TTTGTTTTGCAGAAAGAGCAAGG + Intronic
1202739057 3_GL000221v1_random:37955-37977 CTGGGGATGCAGACAGAGGAGGG - Intergenic
970421005 4:15905784-15905806 TTCGATGTGAAGACAGTGGAAGG - Intergenic
973703432 4:53558638-53558660 TTTGTTATTCTGACAGAGAATGG - Intronic
974659177 4:64864130-64864152 TTTGATGAGCTGAGAGAGGAAGG - Intergenic
976282373 4:83337710-83337732 TATGATATGGATACATAGGAAGG + Intergenic
977294395 4:95194569-95194591 TTGGATTTGAAGACAGCGGAAGG - Intronic
977333365 4:95664862-95664884 TTTGACAAGCTGAGAGAGGAAGG + Intergenic
977952553 4:102990234-102990256 TTTGGGATGTATACAGAGGATGG - Intronic
978008599 4:103651319-103651341 TTTGAAATGAAGACGGAAGAGGG - Intronic
980981901 4:139661677-139661699 TTTGAGATGGAGACAGAGCTTGG + Intergenic
981972558 4:150682456-150682478 TTTGATATTCAGAGAAAGAAAGG - Intronic
982599477 4:157428462-157428484 TTCAATATGCAGTCAGAGTAGGG - Intergenic
983350146 4:166576328-166576350 TTTGAAGTGCAGACAGTGGGAGG + Intergenic
984554618 4:181198987-181199009 TTTGACATGCTCACAGAGGCAGG + Intergenic
985237498 4:187892012-187892034 ATGGATAAGTAGACAGAGGAAGG + Intergenic
1202766857 4_GL000008v2_random:155288-155310 CTGGGGATGCAGACAGAGGAGGG + Intergenic
986050125 5:4082344-4082366 TTTGTTATGAAGACAGAGTCTGG - Intergenic
987182173 5:15379639-15379661 TTTGAAAGGCAGAAAGAAGAAGG + Intergenic
987378575 5:17261617-17261639 TTTGTTATGCAGACGGTGGGGGG - Intronic
987987746 5:25170874-25170896 TCTGTTATGCAGACAGACTAAGG + Intergenic
990853576 5:60236755-60236777 CTGGATTTGAAGACAGAGGAAGG + Intronic
990876161 5:60488556-60488578 TTTGTTATGAAGTCTGAGGAGGG + Intronic
991045833 5:62221766-62221788 TTTGCAAAGAAGACAGAGGAAGG - Intergenic
992706089 5:79394483-79394505 TTTGATATTCAGTGAAAGGATGG + Intronic
995743327 5:115377526-115377548 TTTGTGATCCAGACAGAAGAGGG + Intergenic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
997384001 5:133458453-133458475 TTTGGGATGAAGACAGAGAACGG - Intronic
997824002 5:137090402-137090424 TGTGATCTGCAGAGGGAGGAAGG - Intronic
998039297 5:138942185-138942207 TTGGCTTTGAAGACAGAGGAAGG + Intergenic
998181611 5:139949954-139949976 TTTGCTATTTAGACAGAGGAAGG - Intronic
999507027 5:152208321-152208343 TTTGATGAGCTGAGAGAGGAAGG + Intergenic
999531801 5:152471538-152471560 TTTGATATTCAGAAATAGCATGG + Intergenic
1000138718 5:158380756-158380778 TTGGCTATGCAGAGAAAGGAGGG + Intergenic
1000811374 5:165865892-165865914 TTTTGTATGTAGGCAGAGGAGGG - Intergenic
1001021644 5:168187936-168187958 CTAGAAATGCAGACACAGGAGGG - Intronic
1001673407 5:173492754-173492776 GTTCACATGCACACAGAGGAAGG - Intergenic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1004254948 6:14054871-14054893 AGTGATATGCAGACAGTGGTGGG - Intergenic
1004583759 6:16979535-16979557 TGAGTAATGCAGACAGAGGAGGG - Intergenic
1005423881 6:25680876-25680898 CTGGATTTGGAGACAGAGGAAGG + Intronic
1005775903 6:29130439-29130461 TGAGATATGCAGAAAGTGGAGGG - Intergenic
1005811199 6:29517756-29517778 CTGGATATGCAGACATAGGAAGG - Intergenic
1006770537 6:36548968-36548990 TTGGATTTGCAGACAGAAAATGG - Intergenic
1008735438 6:54538122-54538144 TTCACTATGCAGACAGATGATGG - Intergenic
1009480754 6:64155647-64155669 ATTGCTATGCAGAAAAAGGAAGG + Intronic
1010523794 6:76876029-76876051 TTTGATGAGCTGAGAGAGGAAGG - Intergenic
1011541221 6:88432261-88432283 TTTGATCTGCTGACAGAAGTGGG + Intergenic
1012072533 6:94640829-94640851 TGTGCTTTGAAGACAGAGGAAGG - Intergenic
1012713457 6:102637870-102637892 TTTGCAATGCAGACAAAGTAGGG - Intergenic
1013995076 6:116298458-116298480 TTAGTTTTGAAGACAGAGGACGG + Intronic
1014501673 6:122198408-122198430 TTTGAAATGCACACAGAAGAAGG - Intergenic
1015391962 6:132692521-132692543 TATGATATGAAGACAGAAGAGGG - Exonic
1016092300 6:139994498-139994520 TTTGAGAGGCAGAAAGAGAATGG + Intergenic
1017193424 6:151676930-151676952 TTGGAGATGGAGACAGAGTATGG + Intronic
1017685756 6:156912687-156912709 CATGATATGCAGACACAGGCTGG - Intronic
1017698492 6:157043270-157043292 TTTGAAATGCAGCAAGAGGAAGG - Intronic
1018864245 6:167735026-167735048 TTGGAACTGGAGACAGAGGAAGG - Intergenic
1020593151 7:10168619-10168641 TTTGATGAGCTGAGAGAGGAAGG + Intergenic
1021198899 7:17704697-17704719 TTTGATATGCACCCAGAAGTGGG - Intergenic
1024228851 7:47348719-47348741 TTTGATCTGGAGAAGGAGGATGG + Intronic
1024286906 7:47765710-47765732 TGTGAAATGGAGACAGAGCAGGG - Intronic
1028478699 7:91280369-91280391 CTTGATGTGCAGGCAGAGGAGGG + Intergenic
1029519244 7:101049671-101049693 TTGGATATGCAGAGACAGCAGGG - Intronic
1030977294 7:116142710-116142732 GCAGAGATGCAGACAGAGGAAGG + Intronic
1030997151 7:116372392-116372414 TTTGACAAGCTGAGAGAGGAAGG + Intronic
1031147311 7:118010927-118010949 TTTGAGTTGCAGACAGAACAAGG - Intergenic
1031776854 7:125916415-125916437 TTTGATTTGCTGAGAGATGATGG + Intergenic
1031905147 7:127452096-127452118 TTTGATAAGCTGACAGAAGTAGG + Intergenic
1033734921 7:144212675-144212697 TTTGATAAATAGACAGAGAAAGG - Intergenic
1033748135 7:144338294-144338316 TTTGATAAATAGACAGAGAAAGG + Intergenic
1034851117 7:154494926-154494948 CTCGAGATACAGACAGAGGAGGG + Intronic
1035471459 7:159112550-159112572 TTAAATAGGCAGGCAGAGGAGGG + Intronic
1035899340 8:3441092-3441114 TGTGATATGAAGACAGAGGTAGG + Intronic
1035966636 8:4199282-4199304 ATTGATATGCAGGCAGTGTATGG + Intronic
1036089021 8:5644931-5644953 GTGGAAATGCAGACACAGGAAGG - Intergenic
1037037896 8:14190548-14190570 TTGGATATGTACACAGAAGAGGG + Intronic
1037905657 8:22714665-22714687 TCTGATACCCAGACAGAAGAGGG + Intronic
1038416560 8:27400703-27400725 ATTGAGATCCAGACAGAGAAAGG + Intronic
1038562347 8:28591256-28591278 TTTGATAAGGAGAGAGAGGTGGG + Intergenic
1039436491 8:37563021-37563043 TTTGATATGCAGTTGGTGGATGG - Intergenic
1039504561 8:38042608-38042630 ATTTGGATGCAGACAGAGGAAGG - Intronic
1041441773 8:57904772-57904794 TGGGATATGCAGACTAAGGAGGG + Intergenic
1042115582 8:65427498-65427520 TTTGACAAGTAGAGAGAGGAAGG + Intergenic
1042561773 8:70077251-70077273 TCAGATCTGCAGACAGAGGCAGG - Intergenic
1042590493 8:70393444-70393466 TTTGGTAGGTAGATAGAGGATGG - Intronic
1043773115 8:84229681-84229703 TTTGAGATTAAGAAAGAGGATGG + Intronic
1043779912 8:84319511-84319533 TGTGATATTCAGACAGAGGAAGG + Intronic
1045628702 8:104088675-104088697 TTTGATCTTCAGACAAAAGATGG - Intronic
1045855924 8:106765464-106765486 TTTGCTTTCCTGACAGAGGAGGG - Intronic
1046642251 8:116745352-116745374 TTTGATATGAAGATAGTGAATGG - Intronic
1046702350 8:117415457-117415479 CTTCATATGCAGACACAGCATGG - Intergenic
1047999308 8:130364522-130364544 TTTGATAAGCCAACAGAGCATGG - Intronic
1049385424 8:142340731-142340753 TTTGAGATCCAGACAGTGGTGGG - Intronic
1050237989 9:3603142-3603164 TGTCATATGCAGGAAGAGGAAGG - Intergenic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1051364019 9:16308020-16308042 TGTGATATCCAGACAGCGAATGG - Intergenic
1051701357 9:19827648-19827670 TTTGATTTGCAGAATGAGGGAGG - Intergenic
1052327287 9:27228833-27228855 AATGAGATTCAGACAGAGGAAGG + Intronic
1052876939 9:33574557-33574579 CTAGGGATGCAGACAGAGGAGGG - Intergenic
1053499071 9:38569829-38569851 CTGGGGATGCAGACAGAGGAGGG + Intronic
1053897025 9:42753112-42753134 TGAGGTATGCAGACAAAGGAAGG + Intergenic
1054727875 9:68669909-68669931 TTTGATATGAGGAGAGAGGTGGG - Intergenic
1055860719 9:80746651-80746673 TTTGATTAGCTGACAGAAGAAGG - Intergenic
1056586644 9:87931785-87931807 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1056610233 9:88121156-88121178 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1057162119 9:92896171-92896193 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1057678507 9:97154310-97154332 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1190714212 X:53090473-53090495 TTTGATGTGCTGTCAGAGGTGGG + Intergenic
1192300264 X:69893850-69893872 ATTGAAATCCAGAGAGAGGATGG - Intronic
1192909468 X:75587517-75587539 TTTGACAAGCTGACAGAAGAAGG + Intergenic
1192979807 X:76327775-76327797 TTTGATGAGCTGACAGAAGAAGG - Intergenic
1193364559 X:80616210-80616232 TTTCATATGCATACAGAGATTGG + Intergenic
1193624769 X:83804577-83804599 TTTGGTAAGCAGGCAGAGGGCGG - Intergenic
1194222544 X:91213607-91213629 CTTCATATAGAGACAGAGGAAGG + Intergenic
1198761270 X:140035088-140035110 TCTGTTATGCTGACAGAAGAGGG + Intergenic
1199672513 X:150158995-150159017 TTTCATGTGCAGAAAGAGGGAGG - Intergenic
1199927816 X:152487225-152487247 TTTGCTAGGCAGATAGAGTAGGG - Intergenic
1200598184 Y:5173424-5173446 TTTCATAAGCAGACAGAAAAAGG + Intronic
1201298505 Y:12486102-12486124 TTTAAAAAGCAGACAGAGAAAGG - Intergenic
1201533079 Y:15013816-15013838 TTTGATGAGCTGACAGAAGAAGG + Intergenic
1201885416 Y:18876372-18876394 TGTGAGATGGAGACAGAGAATGG + Intergenic
1202170264 Y:22036025-22036047 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202221101 Y:22550348-22550370 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic
1202322011 Y:23645314-23645336 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202548756 Y:26024742-26024764 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic