ID: 941437980

View in Genome Browser
Species Human (GRCh38)
Location 2:165495557-165495579
Sequence TCATATGTGCATCTTTTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941437980_941437982 -8 Left 941437980 2:165495557-165495579 CCTTGTAAAAGATGCACATATGA No data
Right 941437982 2:165495572-165495594 ACATATGAAGGTTGTGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941437980 Original CRISPR TCATATGTGCATCTTTTACA AGG (reversed) Intronic
No off target data available for this crispr