ID: 941444387

View in Genome Browser
Species Human (GRCh38)
Location 2:165582565-165582587
Sequence GGTCACCCACTTCCTAGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941444387_941444390 -9 Left 941444387 2:165582565-165582587 CCTGTCCTAGGAAGTGGGTGACC No data
Right 941444390 2:165582579-165582601 TGGGTGACCCTGACGGTAAAAGG No data
941444387_941444393 -1 Left 941444387 2:165582565-165582587 CCTGTCCTAGGAAGTGGGTGACC No data
Right 941444393 2:165582587-165582609 CCTGACGGTAAAAGGAATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941444387 Original CRISPR GGTCACCCACTTCCTAGGAC AGG (reversed) Intronic
No off target data available for this crispr