ID: 941446477

View in Genome Browser
Species Human (GRCh38)
Location 2:165606893-165606915
Sequence TGTGAGGCTTAGAACCTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941446471_941446477 29 Left 941446471 2:165606841-165606863 CCATTTTTTATGGAAGTAAAAAT No data
Right 941446477 2:165606893-165606915 TGTGAGGCTTAGAACCTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941446477 Original CRISPR TGTGAGGCTTAGAACCTCTA GGG Intronic
No off target data available for this crispr