ID: 941448909

View in Genome Browser
Species Human (GRCh38)
Location 2:165635183-165635205
Sequence GGCCCCTGGGGTGCCCGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941448902_941448909 -2 Left 941448902 2:165635162-165635184 CCAAAGTGCGCAGCCAGGCTGGG No data
Right 941448909 2:165635183-165635205 GGCCCCTGGGGTGCCCGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941448909 Original CRISPR GGCCCCTGGGGTGCCCGTGA GGG Intronic
No off target data available for this crispr