ID: 941454545

View in Genome Browser
Species Human (GRCh38)
Location 2:165699834-165699856
Sequence AAGCTGATCCTGCAATAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941454544_941454545 -1 Left 941454544 2:165699812-165699834 CCATTACACAGATTTTTTATTTA No data
Right 941454545 2:165699834-165699856 AAGCTGATCCTGCAATAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941454545 Original CRISPR AAGCTGATCCTGCAATAGAT AGG Intergenic
No off target data available for this crispr