ID: 941461769

View in Genome Browser
Species Human (GRCh38)
Location 2:165780434-165780456
Sequence CTAGAAATACAGATCTATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941461769_941461771 -1 Left 941461769 2:165780434-165780456 CCAATATAGATCTGTATTTCTAG No data
Right 941461771 2:165780456-165780478 GGCATGTCTCATTCCCAACATGG No data
941461769_941461772 2 Left 941461769 2:165780434-165780456 CCAATATAGATCTGTATTTCTAG No data
Right 941461772 2:165780459-165780481 ATGTCTCATTCCCAACATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941461769 Original CRISPR CTAGAAATACAGATCTATAT TGG (reversed) Intronic
No off target data available for this crispr