ID: 941463062

View in Genome Browser
Species Human (GRCh38)
Location 2:165793959-165793981
Sequence CCCCTGGGCTGCGTTAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 139}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941463062_941463071 14 Left 941463062 2:165793959-165793981 CCTGCTCTAACGCAGCCCAGGGG 0: 1
1: 0
2: 0
3: 12
4: 139
Right 941463071 2:165793996-165794018 CCGCCTGCCGCCGGCTTACCTGG 0: 1
1: 0
2: 0
3: 14
4: 104
941463062_941463080 27 Left 941463062 2:165793959-165793981 CCTGCTCTAACGCAGCCCAGGGG 0: 1
1: 0
2: 0
3: 12
4: 139
Right 941463080 2:165794009-165794031 GCTTACCTGGCGGGTGGGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 138
941463062_941463073 17 Left 941463062 2:165793959-165793981 CCTGCTCTAACGCAGCCCAGGGG 0: 1
1: 0
2: 0
3: 12
4: 139
Right 941463073 2:165793999-165794021 CCTGCCGCCGGCTTACCTGGCGG 0: 1
1: 0
2: 5
3: 8
4: 86
941463062_941463067 5 Left 941463062 2:165793959-165793981 CCTGCTCTAACGCAGCCCAGGGG 0: 1
1: 0
2: 0
3: 12
4: 139
Right 941463067 2:165793987-165794009 CGTCTCCCTCCGCCTGCCGCCGG 0: 1
1: 0
2: 1
3: 26
4: 196
941463062_941463077 22 Left 941463062 2:165793959-165793981 CCTGCTCTAACGCAGCCCAGGGG 0: 1
1: 0
2: 0
3: 12
4: 139
Right 941463077 2:165794004-165794026 CGCCGGCTTACCTGGCGGGTGGG 0: 1
1: 0
2: 1
3: 0
4: 51
941463062_941463076 21 Left 941463062 2:165793959-165793981 CCTGCTCTAACGCAGCCCAGGGG 0: 1
1: 0
2: 0
3: 12
4: 139
Right 941463076 2:165794003-165794025 CCGCCGGCTTACCTGGCGGGTGG 0: 1
1: 0
2: 1
3: 5
4: 59
941463062_941463074 18 Left 941463062 2:165793959-165793981 CCTGCTCTAACGCAGCCCAGGGG 0: 1
1: 0
2: 0
3: 12
4: 139
Right 941463074 2:165794000-165794022 CTGCCGCCGGCTTACCTGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 97
941463062_941463079 26 Left 941463062 2:165793959-165793981 CCTGCTCTAACGCAGCCCAGGGG 0: 1
1: 0
2: 0
3: 12
4: 139
Right 941463079 2:165794008-165794030 GGCTTACCTGGCGGGTGGGCAGG 0: 1
1: 0
2: 3
3: 10
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941463062 Original CRISPR CCCCTGGGCTGCGTTAGAGC AGG (reversed) Intronic
900598859 1:3494544-3494566 GCCCTGGGCTGCCATAGGGCTGG - Intronic
900911744 1:5601546-5601568 ACCCTGGGCTCCGTTAATGCTGG + Intergenic
901190927 1:7409337-7409359 CCCCTGGCCTCCATCAGAGCTGG + Intronic
902326629 1:15705023-15705045 CGCCAGGGCTGCGTTAGACCAGG - Intronic
903587020 1:24423829-24423851 GCCCTGGGTTGATTTAGAGCAGG + Intronic
904384330 1:30131670-30131692 CCCCTGGGCTGCTGCAGGGCGGG + Intergenic
907159520 1:52360284-52360306 CCCCTGGCCTGTCTTGGAGCAGG - Intronic
910849419 1:91636067-91636089 CTCCCGGGCTGAGTCAGAGCAGG + Intergenic
915473414 1:156138850-156138872 CCCCCGGGCTGCGGAAGAGAAGG - Intronic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
918158336 1:181872599-181872621 CCTTTGGACTGCGTGAGAGCTGG + Intergenic
919945786 1:202318347-202318369 TCCCTGGGCAGCGTTCGAGCAGG + Exonic
920034947 1:203059680-203059702 CCACTGGGCTGTGCAAGAGCTGG - Intronic
922535007 1:226373168-226373190 CTCCTGGCCTGCCTTAGAGCTGG - Intronic
1069698436 10:70404640-70404662 CCCCGGGGCTTCGGTGGAGCTGG - Intronic
1071295204 10:84214446-84214468 CCACTGGGCTGCGCCAGTGCTGG - Exonic
1071515026 10:86291491-86291513 CCCCTGGGCTGAGGCAGGGCTGG - Intronic
1072985814 10:100139287-100139309 AAGCTGGGCTGCATTAGAGCTGG + Intergenic
1073457525 10:103646617-103646639 CCCCTCAGCTGGGTCAGAGCGGG + Intronic
1075197552 10:120374323-120374345 CACCTGGGCTGCCTTAGGTCAGG + Intergenic
1076139059 10:128065073-128065095 CCCCTGGGCTGCATCAGAGATGG + Intronic
1076673388 10:132135371-132135393 CCCCTGCTCTGCGTTAGTGGGGG + Intronic
1076947002 10:133658328-133658350 CCCCTGGGCTGTGTCAGCACAGG - Intergenic
1077037721 11:503349-503371 CCCCGGGGCTGCTTCAGAGGCGG + Exonic
1077110198 11:858913-858935 GCCCGGGGGTGCGTGAGAGCTGG - Intronic
1077110228 11:859025-859047 GCCCGGGGGTGCGTGAGAGCTGG - Intronic
1077922974 11:6655484-6655506 CCCCTGGGCTGCGGCAGCGGCGG - Intronic
1078545438 11:12243617-12243639 ACCCTGGGCTGCTTTAGGGCAGG - Intronic
1078620061 11:12899048-12899070 CCCCTGGGCCAGGTCAGAGCTGG - Intronic
1084113929 11:67030977-67030999 CCCAGGGGCTGCGTTAGGGTAGG - Intronic
1085755962 11:79201625-79201647 CCCCTGGGCTCCCTAAGGGCAGG - Intronic
1101529267 12:105559468-105559490 CCCAGGGCCTGCGTTTGAGCTGG + Intergenic
1103470451 12:121176174-121176196 CCCCTGGGCTAGGTTAGGGCTGG - Intronic
1107495395 13:40921470-40921492 CCCCCAGGCGGCGTTAGAGGTGG - Intergenic
1112341039 13:98553183-98553205 CCTGTGGGGTGCGTGAGAGCCGG + Intronic
1112516587 13:100058570-100058592 GCCCTGGGGTGATTTAGAGCAGG + Intergenic
1112740900 13:102472128-102472150 CCCCTGGGCTCAGCCAGAGCAGG - Intergenic
1115033412 14:28827579-28827601 TCCCAGAGCTGCGTAAGAGCTGG + Intergenic
1115347132 14:32354935-32354957 CCCCTGGGCTGGGAGAAAGCAGG - Intronic
1116257238 14:42571453-42571475 TCCCTGGGCTCAGCTAGAGCAGG + Intergenic
1119649502 14:76373691-76373713 CCCCAGGGCTGTGTGAGAGGAGG + Intronic
1121645779 14:95516488-95516510 TCCCGGGGCTGTGTCAGAGCTGG + Intronic
1122120533 14:99551168-99551190 CCCCAGGACTCCGTTAGGGCTGG - Intronic
1202923844 14_KI270724v1_random:6697-6719 CCCCTGGGCTGTGTCAGCACAGG + Intergenic
1129197897 15:73982037-73982059 CCCCTTGGCTGGGGTAGGGCTGG - Exonic
1129365113 15:75049347-75049369 CCCCTGGGCAGGCTCAGAGCAGG - Exonic
1129617508 15:77110729-77110751 CCCCTAGGCTGAGCTAGAACTGG - Exonic
1130209784 15:81912482-81912504 CCCCTGGGCTGGGTCAGCCCTGG - Intergenic
1132334968 15:101042458-101042480 CCCCTGGGCTGCAGCAGAGCAGG - Intronic
1133232595 16:4373563-4373585 CCCCTGGGCTGCGTGCCAGAGGG - Intronic
1135057533 16:19243053-19243075 CCCATGCCCTGCATTAGAGCAGG + Intronic
1135203910 16:20465706-20465728 ATCCTGGGCTGCATTCGAGCAGG + Exonic
1135215095 16:20559236-20559258 ATCCTGGGCTGCATTCGAGCAGG - Exonic
1135412340 16:22244674-22244696 CCCCTGGGCTGAGTTCCACCTGG + Exonic
1135417591 16:22280396-22280418 CCCCTGGGCTGCAACAGGGCTGG + Intronic
1136872829 16:33824332-33824354 CCCCTGGGCTCAGCCAGAGCAGG - Intergenic
1137571755 16:49570920-49570942 CCCGTGTGCTGGGGTAGAGCAGG + Intronic
1203099342 16_KI270728v1_random:1291722-1291744 CCCCTGGGCTCAGCCAGAGCAGG + Intergenic
1143004326 17:3818419-3818441 TCCCGGGGCTGCTTGAGAGCCGG + Exonic
1143504800 17:7357785-7357807 CCCCTGGGCTAGGTAAGGGCTGG - Intergenic
1144072242 17:11685149-11685171 TCCCTGGGCGGGGTTAAAGCTGG - Intronic
1147772442 17:42877310-42877332 CCCCTGGGCTGGGTTAGCCTTGG + Intergenic
1148774509 17:50088026-50088048 CCCCTGGCCTGGGTTAGTGGGGG + Intronic
1151678608 17:75612742-75612764 CCCCTGGGCTGTCTGATAGCTGG + Intergenic
1152471825 17:80493770-80493792 CCCCAGGCCAGCGTGAGAGCTGG + Intergenic
1152689418 17:81711317-81711339 CCCCAAGGCTGCTTTAGGGCTGG - Intergenic
1203170906 17_GL000205v2_random:147287-147309 CCCCTGGGCTGTGTTAGCAAGGG - Intergenic
1153794840 18:8611955-8611977 CCCCTGGCCTGCTGCAGAGCGGG + Intronic
1160147844 18:76379087-76379109 CTCCTGGGCTGCCTTCGAGGGGG + Exonic
1161153955 19:2722736-2722758 GCCATGGGTGGCGTTAGAGCAGG - Intronic
1163544311 19:17932033-17932055 CCCAGGGGAGGCGTTAGAGCAGG + Intergenic
1164853284 19:31501942-31501964 CTCCTGGGCTTCCTTAGGGCTGG + Intergenic
1167385391 19:49160058-49160080 CCACTGGGCTCTGTGAGAGCTGG + Intronic
925025314 2:602450-602472 CCCCAGGCCTGTGTCAGAGCCGG - Intergenic
925144863 2:1574470-1574492 CCGCTGGGGTATGTTAGAGCAGG + Intergenic
925867136 2:8238224-8238246 CCACTGGGCTGCTTCAGAGCAGG + Intergenic
932791684 2:74659020-74659042 CCCCTGGGCTGCCTTGGGGTGGG + Intronic
933275850 2:80283721-80283743 CCCCTGTGCTCTCTTAGAGCTGG + Intronic
934712259 2:96523776-96523798 ACCCTGGGCTGGGGGAGAGCAGG - Intergenic
936228195 2:110677811-110677833 GCCGTGGGCTGCTTGAGAGCCGG - Intronic
936867126 2:117087552-117087574 CTCCTGGGCTGTGACAGAGCAGG + Intergenic
941463062 2:165793959-165793981 CCCCTGGGCTGCGTTAGAGCAGG - Intronic
942263573 2:174197517-174197539 CCCCTGGGCTTCATTGGAGTTGG - Intronic
946160598 2:217833503-217833525 CACCTGGGCTGTGCTAGAACTGG - Intronic
946297871 2:218800073-218800095 CCCCTTGGCTGCGGTCTAGCAGG - Intronic
948305780 2:236945777-236945799 CCCCAGGGCTGAGCTATAGCTGG - Intergenic
1172510821 20:35499776-35499798 CCCCTGGGCTAACTTTGAGCAGG + Intronic
1176326891 21:5509118-5509140 CCCCTGGGCTGTGTTAGCAAAGG - Intergenic
1176400866 21:6311833-6311855 CCCCTGGGCTGTGTTAGCAAAGG + Intergenic
1176436291 21:6677271-6677293 CCCCTGGGCTGTGTTAGCAAAGG - Intergenic
1176460553 21:7004341-7004363 CCCCTGGGCTGTGTTAGCAAAGG - Intergenic
1176484114 21:7386119-7386141 CCCCTGGGCTGTGTTAGCAAAGG - Intergenic
1178314091 21:31554785-31554807 CCTCTGGGCTGAGGCAGAGCTGG - Intronic
1178492055 21:33058679-33058701 GCCCTGGGCTGGGTTCCAGCTGG - Intergenic
1179711275 21:43264634-43264656 GCCCTGGGATGATTTAGAGCAGG + Intergenic
1183284934 22:36956051-36956073 CTCCTGGGCTGGTTTAGTGCTGG - Intergenic
1183580861 22:38725927-38725949 CCCCTGGTCTGTGTCAGGGCAGG + Intronic
1183696638 22:39427398-39427420 TCCCTGGGCTGCACTGGAGCAGG + Intronic
1184449068 22:44572234-44572256 GCCCTGGGCTGCGGCAGTGCTGG - Intergenic
1184461288 22:44639628-44639650 CCTCTGTGCTTCGATAGAGCTGG + Intergenic
1185173655 22:49307258-49307280 GCCCTGGGCTGGGGCAGAGCCGG + Intergenic
1185249255 22:49791160-49791182 CCCCGGGGCTGCGTGTCAGCTGG - Intronic
950399319 3:12758614-12758636 CCCCGGGGGTGCCTTTGAGCTGG + Intronic
951562439 3:23982095-23982117 TCCCTAGGCTGAGTCAGAGCTGG - Intergenic
957080460 3:75632088-75632110 CCCCTGGGCTGTGTCAGCACAGG + Intergenic
957204601 3:77179979-77180001 ACCCTGGGCTGTGTTTGAGATGG + Intronic
961464626 3:127073594-127073616 CCTCTGGGCTGCTGTAGAACTGG + Intergenic
964358584 3:155871357-155871379 CTCCTGTGCGGCGTTGGAGCTGG + Intronic
967890124 3:194359025-194359047 CCCCTGGGCTTCCTTCGAGAGGG - Exonic
968814704 4:2815800-2815822 CCCCTGGGCTGGGTCTGAGCTGG + Intronic
968915141 4:3493995-3494017 CCCCTGGGCTCCGTGTGCGCTGG + Exonic
969354753 4:6618896-6618918 TCCCTGGCCTGCCTGAGAGCAGG + Intronic
969629118 4:8325214-8325236 CTCCAGGACTGGGTTAGAGCTGG + Intergenic
971233977 4:24824999-24825021 TCCCTGGGCTGCGTCATACCAGG - Intronic
985450460 4:190059127-190059149 CCCCTGGGCTGTGTCAGCACAGG - Intergenic
985720509 5:1486287-1486309 CCCCTGGCCTGGGTCAGAACAGG + Intronic
994411339 5:99410504-99410526 CCTCTGGGCTGCCTGAGCGCCGG - Intergenic
994482490 5:100354743-100354765 CCTCTGGGCTGCCTGAGCGCCGG + Intergenic
994781535 5:104095728-104095750 TCCCAAGGCTGCATTAGAGCAGG + Intergenic
997813218 5:136992485-136992507 GCCTTGGGCTGTGTTGGAGCTGG + Exonic
998869899 5:146541814-146541836 CTCCTGGGATGCGATAGAGTCGG + Intergenic
1001260904 5:170227618-170227640 CCCCTGGGAGGCTTTAAAGCAGG + Intergenic
1006913795 6:37581719-37581741 CCCATGGGAAGCGTTAGAGAAGG + Intergenic
1007661781 6:43491098-43491120 CCCTTGGGCTGGGTGAGAGAAGG + Intronic
1008188308 6:48422880-48422902 GCCCTGGGCTCCGCCAGAGCAGG - Intergenic
1009196738 6:60695514-60695536 GCCCTGGGCTCAGTCAGAGCAGG + Intergenic
1011366140 6:86584682-86584704 CTTCTGGGCTGCCTGAGAGCTGG - Intergenic
1018847943 6:167568019-167568041 CCCCTGCGTTGCTTTACAGCAGG - Intergenic
1019105743 6:169665277-169665299 CCCCTGGTCTGCGGAGGAGCTGG - Intronic
1020021371 7:4871548-4871570 CCCCAGTGCTGCGATGGAGCTGG - Intronic
1021561385 7:21972021-21972043 GCCCTGGGCTCAGCTAGAGCAGG - Intergenic
1023850161 7:44145952-44145974 ACCCTGGGCTTAGTTAGAGGGGG - Intronic
1024668583 7:51569386-51569408 CCCCTTGGCTGCTTTATTGCTGG - Intergenic
1031982599 7:128137187-128137209 CCCCTGGGCCATGTAAGAGCTGG + Intergenic
1034943190 7:155245164-155245186 CCCCTGGGATGGGTGAGAGGAGG - Intergenic
1035181141 7:157090514-157090536 CCCCCGGGCTGCGCTAGCCCAGG + Intergenic
1035205065 7:157289791-157289813 CCCCTGGGCAGGGCTAGAGCAGG - Intergenic
1035312689 7:157979833-157979855 GGCCTGGGCTGCGATTGAGCAGG - Intronic
1037504333 8:19515394-19515416 CCCCTGGGCTGGGTCAGTGCTGG - Intronic
1038848408 8:31251266-31251288 CCCCTGGGCTGGATTCGTGCCGG + Intergenic
1039493390 8:37964389-37964411 TCCCTGGGCTGGGTTGGAGTAGG - Intronic
1040811667 8:51460905-51460927 CTGCTGGGCTGGGATAGAGCAGG + Intronic
1044930685 8:97248857-97248879 TCCCTGGCCTGCCTCAGAGCAGG + Intergenic
1049267498 8:141676656-141676678 CCCCTTGGCTCCGTTTCAGCTGG + Intergenic
1051124053 9:13783888-13783910 CCACTGTGCTGGGTTAGAGCAGG - Intergenic
1051145605 9:14024218-14024240 CTCCTGGTCTCCGTAAGAGCTGG - Intergenic
1057696435 9:97326161-97326183 CTCCTGGACTGTGTGAGAGCAGG - Intronic
1058091942 9:100814522-100814544 GCCCTGGGCTCAGTCAGAGCAGG + Intergenic
1060201196 9:121652500-121652522 CCCGGGGGCTGCGTTTGGGCGGG + Intronic
1062466942 9:136685749-136685771 CCCCTGGGGTGCTTCAGAGTAGG - Intronic
1186423239 X:9443449-9443471 CACCTGGGTTCCGTTAGGGCTGG - Intergenic
1194380306 X:93181941-93181963 GCCCTGGGCTCAGCTAGAGCAGG + Intergenic