ID: 941463590

View in Genome Browser
Species Human (GRCh38)
Location 2:165799738-165799760
Sequence CAGTTGGGCTGGAGGGGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941463590_941463600 10 Left 941463590 2:165799738-165799760 CCAAATCCCCTCCAGCCCAACTG No data
Right 941463600 2:165799771-165799793 TCTCCCATGGAGTCTTGATATGG No data
941463590_941463597 -3 Left 941463590 2:165799738-165799760 CCAAATCCCCTCCAGCCCAACTG No data
Right 941463597 2:165799758-165799780 CTGAAGACCCTAGTCTCCCATGG No data
941463590_941463603 15 Left 941463590 2:165799738-165799760 CCAAATCCCCTCCAGCCCAACTG No data
Right 941463603 2:165799776-165799798 CATGGAGTCTTGATATGGTTTGG No data
941463590_941463604 18 Left 941463590 2:165799738-165799760 CCAAATCCCCTCCAGCCCAACTG No data
Right 941463604 2:165799779-165799801 GGAGTCTTGATATGGTTTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941463590 Original CRISPR CAGTTGGGCTGGAGGGGATT TGG (reversed) Intergenic
No off target data available for this crispr