ID: 941464085

View in Genome Browser
Species Human (GRCh38)
Location 2:165804858-165804880
Sequence GCAAACTGACAGGCTGTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941464085_941464089 24 Left 941464085 2:165804858-165804880 CCTGAGACAGCCTGTCAGTTTGC No data
Right 941464089 2:165804905-165804927 CCTCACAGACCACGATGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941464085 Original CRISPR GCAAACTGACAGGCTGTCTC AGG (reversed) Intergenic
No off target data available for this crispr