ID: 941464087

View in Genome Browser
Species Human (GRCh38)
Location 2:165804868-165804890
Sequence ATTCCATAAAGCAAACTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941464087_941464089 14 Left 941464087 2:165804868-165804890 CCTGTCAGTTTGCTTTATGGAAT No data
Right 941464089 2:165804905-165804927 CCTCACAGACCACGATGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941464087 Original CRISPR ATTCCATAAAGCAAACTGAC AGG (reversed) Intergenic
No off target data available for this crispr