ID: 941464089

View in Genome Browser
Species Human (GRCh38)
Location 2:165804905-165804927
Sequence CCTCACAGACCACGATGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941464087_941464089 14 Left 941464087 2:165804868-165804890 CCTGTCAGTTTGCTTTATGGAAT No data
Right 941464089 2:165804905-165804927 CCTCACAGACCACGATGAACTGG No data
941464085_941464089 24 Left 941464085 2:165804858-165804880 CCTGAGACAGCCTGTCAGTTTGC No data
Right 941464089 2:165804905-165804927 CCTCACAGACCACGATGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941464089 Original CRISPR CCTCACAGACCACGATGAAC TGG Intergenic
No off target data available for this crispr