ID: 941465461

View in Genome Browser
Species Human (GRCh38)
Location 2:165821125-165821147
Sequence CAGCAATGCCTTTTGGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941465461_941465464 -3 Left 941465461 2:165821125-165821147 CCTCTGCCCAAAAGGCATTGCTG No data
Right 941465464 2:165821145-165821167 CTGTTTCCATTTAAGATTTATGG No data
941465461_941465465 1 Left 941465461 2:165821125-165821147 CCTCTGCCCAAAAGGCATTGCTG No data
Right 941465465 2:165821149-165821171 TTCCATTTAAGATTTATGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941465461 Original CRISPR CAGCAATGCCTTTTGGGCAG AGG (reversed) Intergenic
No off target data available for this crispr