ID: 941465463

View in Genome Browser
Species Human (GRCh38)
Location 2:165821132-165821154
Sequence ATGGAAACAGCAATGCCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941465463_941465465 -6 Left 941465463 2:165821132-165821154 CCAAAAGGCATTGCTGTTTCCAT No data
Right 941465465 2:165821149-165821171 TTCCATTTAAGATTTATGGTTGG No data
941465463_941465464 -10 Left 941465463 2:165821132-165821154 CCAAAAGGCATTGCTGTTTCCAT No data
Right 941465464 2:165821145-165821167 CTGTTTCCATTTAAGATTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941465463 Original CRISPR ATGGAAACAGCAATGCCTTT TGG (reversed) Intergenic
No off target data available for this crispr