ID: 941465464

View in Genome Browser
Species Human (GRCh38)
Location 2:165821145-165821167
Sequence CTGTTTCCATTTAAGATTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941465462_941465464 -9 Left 941465462 2:165821131-165821153 CCCAAAAGGCATTGCTGTTTCCA No data
Right 941465464 2:165821145-165821167 CTGTTTCCATTTAAGATTTATGG No data
941465463_941465464 -10 Left 941465463 2:165821132-165821154 CCAAAAGGCATTGCTGTTTCCAT No data
Right 941465464 2:165821145-165821167 CTGTTTCCATTTAAGATTTATGG No data
941465461_941465464 -3 Left 941465461 2:165821125-165821147 CCTCTGCCCAAAAGGCATTGCTG No data
Right 941465464 2:165821145-165821167 CTGTTTCCATTTAAGATTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941465464 Original CRISPR CTGTTTCCATTTAAGATTTA TGG Intergenic
No off target data available for this crispr