ID: 941465733

View in Genome Browser
Species Human (GRCh38)
Location 2:165824339-165824361
Sequence CAGAATAAGAAGATGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941465733_941465736 -10 Left 941465733 2:165824339-165824361 CCTCCTTCCATCTTCTTATTCTG No data
Right 941465736 2:165824352-165824374 TCTTATTCTGTAACAGACTTTGG No data
941465733_941465737 -9 Left 941465733 2:165824339-165824361 CCTCCTTCCATCTTCTTATTCTG No data
Right 941465737 2:165824353-165824375 CTTATTCTGTAACAGACTTTGGG No data
941465733_941465738 -8 Left 941465733 2:165824339-165824361 CCTCCTTCCATCTTCTTATTCTG No data
Right 941465738 2:165824354-165824376 TTATTCTGTAACAGACTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941465733 Original CRISPR CAGAATAAGAAGATGGAAGG AGG (reversed) Intergenic
No off target data available for this crispr