ID: 941470833

View in Genome Browser
Species Human (GRCh38)
Location 2:165884970-165884992
Sequence TTGTATTTTCAGTTGAGGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941470833_941470840 30 Left 941470833 2:165884970-165884992 CCTCGCCTCAACTGAAAATACAA No data
Right 941470840 2:165885023-165885045 CCCTGTAGTCCCAGCTACTCAGG 0: 1264
1: 104922
2: 239865
3: 244476
4: 148981
941470833_941470835 -1 Left 941470833 2:165884970-165884992 CCTCGCCTCAACTGAAAATACAA No data
Right 941470835 2:165884992-165885014 AAAGAAAAACTAGCTGAGTGTGG No data
941470833_941470836 2 Left 941470833 2:165884970-165884992 CCTCGCCTCAACTGAAAATACAA No data
Right 941470836 2:165884995-165885017 GAAAAACTAGCTGAGTGTGGTGG 0: 3
1: 119
2: 3670
3: 38857
4: 99208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941470833 Original CRISPR TTGTATTTTCAGTTGAGGCG AGG (reversed) Intronic
No off target data available for this crispr