ID: 941470835

View in Genome Browser
Species Human (GRCh38)
Location 2:165884992-165885014
Sequence AAAGAAAAACTAGCTGAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941470834_941470835 -6 Left 941470834 2:165884975-165884997 CCTCAACTGAAAATACAAAAGAA No data
Right 941470835 2:165884992-165885014 AAAGAAAAACTAGCTGAGTGTGG No data
941470833_941470835 -1 Left 941470833 2:165884970-165884992 CCTCGCCTCAACTGAAAATACAA No data
Right 941470835 2:165884992-165885014 AAAGAAAAACTAGCTGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941470835 Original CRISPR AAAGAAAAACTAGCTGAGTG TGG Intronic
No off target data available for this crispr