ID: 941470836

View in Genome Browser
Species Human (GRCh38)
Location 2:165884995-165885017
Sequence GAAAAACTAGCTGAGTGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141857
Summary {0: 3, 1: 119, 2: 3670, 3: 38857, 4: 99208}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941470833_941470836 2 Left 941470833 2:165884970-165884992 CCTCGCCTCAACTGAAAATACAA No data
Right 941470836 2:165884995-165885017 GAAAAACTAGCTGAGTGTGGTGG 0: 3
1: 119
2: 3670
3: 38857
4: 99208
941470834_941470836 -3 Left 941470834 2:165884975-165884997 CCTCAACTGAAAATACAAAAGAA No data
Right 941470836 2:165884995-165885017 GAAAAACTAGCTGAGTGTGGTGG 0: 3
1: 119
2: 3670
3: 38857
4: 99208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941470836 Original CRISPR GAAAAACTAGCTGAGTGTGG TGG Intronic
Too many off-targets to display for this crispr