ID: 941470840

View in Genome Browser
Species Human (GRCh38)
Location 2:165885023-165885045
Sequence CCCTGTAGTCCCAGCTACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 739508
Summary {0: 1264, 1: 104922, 2: 239865, 3: 244476, 4: 148981}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941470834_941470840 25 Left 941470834 2:165884975-165884997 CCTCAACTGAAAATACAAAAGAA No data
Right 941470840 2:165885023-165885045 CCCTGTAGTCCCAGCTACTCAGG 0: 1264
1: 104922
2: 239865
3: 244476
4: 148981
941470833_941470840 30 Left 941470833 2:165884970-165884992 CCTCGCCTCAACTGAAAATACAA No data
Right 941470840 2:165885023-165885045 CCCTGTAGTCCCAGCTACTCAGG 0: 1264
1: 104922
2: 239865
3: 244476
4: 148981

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941470840 Original CRISPR CCCTGTAGTCCCAGCTACTC AGG Intronic
Too many off-targets to display for this crispr